AT1G17490

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
6008437 .. 6009420
984 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G17490.1

Sequence Viewer

Length: 234 bp
ATGGCGGAACCAAAACAAAGCTCTCTTTCTGAGGTGAAGACAAATGTGATTGGAAGCAGAAAAGAAGAGAAGGAATCGATGTTTCATGGGAAAGAGACTCATGGAAGAAGTGAAGACATTGATGAGAAGACAAGGGTTGATGATGTTAAAGGACCTGGTGTTCTCGGGCGTATGATGGAAGAAATGGAAGCCATTGTTGACGCTGTTACTCCTAACAAAAGTTCTGACAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.55

Weight (kDa)

5.15

Isoelectric Point (pI)

42.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AjnI CCWGG 1 cut(s) 154
AloI GAACNNNNNNTCC 2 cut(s) 144, 176
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
Alw26I GTCTC 1 cut(s) 89
Ama87I CYCGRG 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 152
AsuHPI GGTGA 1 cut(s) 46
AvaI CYCGRG 1 cut(s) 164
AvaII GGWCC 1 cut(s) 152
BbsI GAAGAC 3 cut(s) 44, 120, 134
BccI CCATC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 156
BcoDI GTCTC 1 cut(s) 89
Bme1390I CCNGG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 152
BmeT110I CYCGRG 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 152
BmiI GGNNCC 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 156
BpiI GAAGAC 3 cut(s) 44, 120, 134
Bsa29I ATCGAT 1 cut(s) 77
BseBI CCWGG 1 cut(s) 156
BseCI ATCGAT 1 cut(s) 77
BseMII CTCAG 1 cut(s) 21
BshVI ATCGAT 1 cut(s) 77
BsiHKCI CYCGRG 1 cut(s) 164
BsmAI GTCTC 1 cut(s) 89
BsoBI CYCGRG 1 cut(s) 164
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 22
BspDI ATCGAT 1 cut(s) 77
BspLI GGNNCC 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 30
BstMAI GTCTC 1 cut(s) 89
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstV2I GAAGAC 3 cut(s) 44, 120, 134
Bsu15I ATCGAT 1 cut(s) 77
BsuTUI ATCGAT 1 cut(s) 77
Cfr13I GGNCC 1 cut(s) 152
ClaI ATCGAT 1 cut(s) 77
CseI GACGC 1 cut(s) 209
CsiI ACCWGGT 1 cut(s) 154
CviAII CATG 2 cut(s) 86, 101
CviJI RGCY 2 cut(s) 21, 191
CviKI_1 RGCY 2 cut(s) 21, 191
DdeI CTNAG 1 cut(s) 30
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
EciI GGCGGA 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 152
Eco88I CYCGRG 1 cut(s) 164
EcoO109I RGGNCCY 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 2 cut(s) 89, 104
FaiI YATR 3 cut(s) 87, 102, 173
FatI CATG 2 cut(s) 85, 100
HgaI GACGC 1 cut(s) 209
Hin1II CATG 2 cut(s) 89, 104
HincII GTYRAC 1 cut(s) 199
HindII GTYRAC 1 cut(s) 199
HinfI GANTC 2 cut(s) 74, 97
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 2 cut(s) 31, 226
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 30
Hsp92II CATG 2 cut(s) 89, 104
LpnPI CCDG 2 cut(s) 141, 168
MabI ACCWGGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 205
MboII GAAGA 6 cut(s) 49, 77, 117, 125, 139, 191
MlyI GAGTC 1 cut(s) 91
MnlI CCTC 1 cut(s) 25
MseI TTAA 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NlaIII CATG 2 cut(s) 89, 104
NlaIV GGNNCC 1 cut(s) 9
PfeI GAWTC 1 cut(s) 74
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
PpuMI RGGWCCY 1 cut(s) 152
Psp5II RGGWCCY 1 cut(s) 152
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 9
PspPI GGNCC 1 cut(s) 152
PspPPI RGGWCCY 1 cut(s) 152
SaqAI TTAA 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 152
SchI GAGTC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 156
SetI ASST 3 cut(s) 23, 36, 157
SexAI ACCWGGT 1 cut(s) 154
SgeI CNNG 7 cut(s) 98, 113, 144, 167, 168, 176, 178
SinI GGWCC 1 cut(s) 152
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 154
TaqI TCGA 1 cut(s) 77
TfiI GAWTC 1 cut(s) 74
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.