Rh3AG094900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
7808439 .. 7809019
581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG094900.1

Sequence Viewer

Length: 366 bp
ATGTTGCATCACAAAGACGAATCAAATCACCATCACGAGGAAACTCATGGTTTGCGTAAAGACATTGATGAGAAGACCCCATTAGAGGAAGTTAAAGCTCCAAATGTGTTTGAGCGAGCAAAGGAGGAGTTCGAGGCTATAGTTGAAGCAATTCATTCCAAGAAGGAATCTGATTCGAGTGTTGAAATTAAAAAGGAGTCAAAGCAGGACAAAGCTGAATCAAAATCAGAAAATAATGGCAACTCACCTAGATTTGTAGATTATGCCAAGGGAAAGATTAAAACAATCATGCACCATGACAAGTCGCCAAAGCTTCACAACGAAAAAGCTTCACAACAATTGATAAACGTGGAGCCCCTCTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

14.01

Weight (kDa)

6.2

Isoelectric Point (pI)

51.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 37, 85
AgsI TTSAA 2 cut(s) 146, 185
AluBI AGCT 4 cut(s) 98, 215, 313, 329
AluI AGCT 4 cut(s) 98, 215, 313, 329
Asp700I GAANNNNTTC 1 cut(s) 150
AsuHPI GGTGA 2 cut(s) 20, 237
BanII GRGCYC 1 cut(s) 357
BauI CACGAG 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 80
BccI CCATC 1 cut(s) 39
BfaI CTAG 1 cut(s) 249
BfmI CTRYAG 1 cut(s) 138
BmiI GGNNCC 1 cut(s) 354
BmsI GCATC 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 267
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 85
BseDI CCNNGG 1 cut(s) 267
BseLI CCNNNNNNNGG 2 cut(s) 37, 85
BseRI GAGGAG 1 cut(s) 140
BslI CCNNNNNNNGG 2 cut(s) 37, 85
Bsp1286I GDGCHC 1 cut(s) 357
BspLI GGNNCC 1 cut(s) 354
BssECI CCNNGG 1 cut(s) 267
BssSI CACGAG 1 cut(s) 35
BssT1I CCWWGG 1 cut(s) 267
Bst2BI CACGAG 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 117
BstSFI CTRYAG 1 cut(s) 138
BstV2I GAAGAC 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 117
CviAII CATG 3 cut(s) 47, 289, 296
CviJI RGCY 6 cut(s) 98, 137, 215, 313, 329, 355
CviKI_1 RGCY 6 cut(s) 98, 137, 215, 313, 329, 355
Eco130I CCWWGG 1 cut(s) 267
Eco24I GRGCYC 1 cut(s) 357
EcoT14I CCWWGG 1 cut(s) 267
EcoT38I GRGCYC 1 cut(s) 357
ErhI CCWWGG 1 cut(s) 267
FaeI CATG 3 cut(s) 50, 292, 299
FaiI YATR 5 cut(s) 48, 140, 264, 290, 297
FatI CATG 3 cut(s) 46, 288, 295
FriOI GRGCYC 1 cut(s) 357
FspBI CTAG 1 cut(s) 249
Hin1II CATG 3 cut(s) 50, 292, 299
HindIII AAGCTT 2 cut(s) 311, 327
HinfI GANTC 5 cut(s) 20, 167, 173, 197, 218
HphI GGTGA 2 cut(s) 20, 237
Hpy188I TCNGA 2 cut(s) 172, 229
Hpy188III TCNNGA 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 157
HpyCH4IV ACGT 1 cut(s) 348
HpyCH4V TGCA 2 cut(s) 7, 292
HpySE526I ACGT 1 cut(s) 348
Hsp92II CATG 3 cut(s) 50, 292, 299
LmnI GCTCC 2 cut(s) 103, 352
LpnPI CCDG 2 cut(s) 191, 346
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 249
MaeII ACGT 1 cut(s) 348
MboII GAAGA 1 cut(s) 85
MfeI CAATTG 1 cut(s) 338
MhlI GDGCHC 1 cut(s) 357
MluCI AATT 3 cut(s) 150, 186, 338
MlyI GAGTC 1 cut(s) 206
MnlI CCTC 4 cut(s) 31, 79, 118, 127
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 3 cut(s) 93, 189, 279
MunI CAATTG 1 cut(s) 338
NlaIII CATG 3 cut(s) 50, 292, 299
NlaIV GGNNCC 1 cut(s) 354
PdmI GAANNNNTTC 1 cut(s) 150
PfeI GAWTC 4 cut(s) 20, 167, 173, 218
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PspN4I GGNNCC 1 cut(s) 354
SaqAI TTAA 3 cut(s) 93, 189, 279
SchI GAGTC 1 cut(s) 206
SduI GDGCHC 1 cut(s) 357
SetI ASST 6 cut(s) 100, 217, 250, 315, 331, 351
SfaNI GCATC 1 cut(s) 16
SfcI CTRYAG 1 cut(s) 138
Sse9I AATT 3 cut(s) 150, 186, 338
SspMI CTAG 1 cut(s) 249
StyI CCWWGG 1 cut(s) 267
TaiI ACGT 1 cut(s) 351
TaqI TCGA 2 cut(s) 132, 176
TasI AATT 3 cut(s) 150, 186, 338
TfiI GAWTC 4 cut(s) 20, 167, 173, 218
Tru1I TTAA 3 cut(s) 93, 189, 279
Tru9I TTAA 3 cut(s) 93, 189, 279
TspDTI ATGAA 1 cut(s) 143
XmnI GAANNNNTTC 1 cut(s) 150
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.