Prupe.7G206700_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
19048411 .. 19050256
1846 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G206700.1

Sequence Viewer

Length: 636 bp
ATGGCGGAATCCAAACCCAGCCCAACGCAAGCTTCACCCGATAAGGAAGTAAAGGCACCTAATTTGATTGAAAGAGCAAAGGAAGAGATTGGAGCAATAATGCACACTGAAAAATCACATAACGATCACAAGGAAACTCATGGCATGCGTACGGATATTGATGAAAAGACCCCACTAGACAATGTCAAAGCTCCAAATATGTTTGAACGAGCGAAGGAGGAGTTTGAGGCTATAGTTGAAGCAATCCATCCCAAGACAGAGTCTCCCACTCATGGCAAAAGGGAGGAAAAAAAGGAGTCGAAAAAACAGGAGAAAACCGACTCTCAATCAGAAAATAATGCCAAGACAACTAACTTTATTGGGAAAGCGAAGGAAAAGATTGGAACGATCATGCACCATGAGAAGTCACCAAAGCTTCATGATAAAGAAACTCATGACAAGTCACCAAAGCATCATACTGAAGAAACTCATGGAACGAGTGATGACATAGATGCGAATATCCCAATCGATCATGTTAAGGCTCCGAATGTTTTTGAAAGAGCAAAGGAGGAAATCGAGGCTATTGTCCAATCGATTCATCCCAAGAAAAAAGAGAAAAATCCAGTTTCTTCACCTAAGAAGGAAGGTGGACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

212

Amino Acids

23.8

Weight (kDa)

6.44

Isoelectric Point (pI)

58.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 55
AciI CCGC 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 480
AfaI GTAC 1 cut(s) 151
AfiI CCNNNNNNNGG 1 cut(s) 272
AgsI TTSAA 4 cut(s) 71, 206, 239, 536
AjuI GAANNNNNNNTTGG 2 cut(s) 16, 48
AluBI AGCT 3 cut(s) 32, 191, 415
AluI AGCT 3 cut(s) 32, 191, 415
Alw26I GTCTC 1 cut(s) 267
AsuHPI GGTGA 4 cut(s) 27, 399, 435, 603
BanI GGYRCC 1 cut(s) 55
BccI CCATC 1 cut(s) 255
BcoDI GTCTC 1 cut(s) 267
BfaI CTAG 1 cut(s) 176
BfmI CTRYAG 1 cut(s) 231
BmiI GGNNCC 2 cut(s) 57, 522
BmsI GCATC 2 cut(s) 460, 481
Bsa29I ATCGAT 2 cut(s) 507, 572
BsaXI ACNNNNNCTCC 2 cut(s) 247, 277
Bsc4I CCNNNNNNNGG 1 cut(s) 272
Bse1I ACTGG 1 cut(s) 602
BseCI ATCGAT 2 cut(s) 507, 572
BseGI GGATG 2 cut(s) 247, 577
BseLI CCNNNNNNNGG 1 cut(s) 272
BseNI ACTGG 1 cut(s) 602
BseRI GAGGAG 1 cut(s) 233
BseYI CCCAGC 1 cut(s) 17
BshNI GGYRCC 1 cut(s) 55
BshVI ATCGAT 2 cut(s) 507, 572
BsiWI CGTACG 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 272
BsmAI GTCTC 1 cut(s) 267
Bsp143I GATC 3 cut(s) 124, 387, 508
BspACI CCGC 1 cut(s) 5
BspDI ATCGAT 2 cut(s) 507, 572
BspHI TCATGA 2 cut(s) 418, 433
BspLI GGNNCC 2 cut(s) 57, 522
BspT107I GGYRCC 1 cut(s) 55
BsrI ACTGG 1 cut(s) 602
BssMI GATC 3 cut(s) 124, 387, 508
Bst4CI ACNGT 1 cut(s) 633
Bst6I CTCTTC 1 cut(s) 78
BstC8I GCNNGC 2 cut(s) 30, 146
BstDEI CTNAG 1 cut(s) 615
BstF5I GGATG 2 cut(s) 247, 577
BstKTI GATC 3 cut(s) 127, 390, 511
BstMAI GTCTC 1 cut(s) 267
BstMBI GATC 3 cut(s) 124, 387, 508
BstNSI RCATGY 1 cut(s) 148
BstSFI CTRYAG 1 cut(s) 231
Bsu15I ATCGAT 2 cut(s) 507, 572
BsuTUI ATCGAT 2 cut(s) 507, 572
BtsCI GGATG 2 cut(s) 247, 577
BtsIMutI CAGTG 1 cut(s) 105
Cac8I GCNNGC 2 cut(s) 30, 146
CciI TCATGA 2 cut(s) 418, 433
ClaI ATCGAT 2 cut(s) 507, 572
Csp6I GTAC 1 cut(s) 150
CviAII CATG 9 cut(s) 140, 145, 272, 391, 398, 419, 434, 470, 512
CviJI RGCY 7 cut(s) 21, 32, 191, 230, 415, 521, 560
CviKI_1 RGCY 7 cut(s) 21, 32, 191, 230, 415, 521, 560
CviQI GTAC 1 cut(s) 150
DdeI CTNAG 1 cut(s) 615
DpnI GATC 3 cut(s) 126, 389, 510
DpnII GATC 3 cut(s) 124, 387, 508
Eam1104I CTCTTC 1 cut(s) 78
EarI CTCTTC 1 cut(s) 78
EciI GGCGGA 1 cut(s) 20
Eco57I CTGAAG 1 cut(s) 480
FaeI CATG 9 cut(s) 143, 148, 275, 394, 401, 422, 437, 473, 515
FatI CATG 9 cut(s) 139, 144, 271, 390, 397, 418, 433, 469, 511
FokI GGATG 2 cut(s) 234, 564
FspBI CTAG 1 cut(s) 176
GsaI CCCAGC 1 cut(s) 21
Hin1II CATG 9 cut(s) 143, 148, 275, 394, 401, 422, 437, 473, 515
HindIII AAGCTT 2 cut(s) 30, 413
HinfI GANTC 5 cut(s) 8, 260, 296, 320, 574
HphI GGTGA 4 cut(s) 27, 399, 435, 603
Hpy166II GTNNAC 1 cut(s) 629
Hpy188I TCNGA 2 cut(s) 331, 525
Hpy188III TCNNGA 2 cut(s) 419, 434
Hpy8I GTNNAC 1 cut(s) 629
HpyAV CCTTC 4 cut(s) 208, 364, 613, 617
HpyCH4III ACNGT 1 cut(s) 633
HpyCH4V TGCA 2 cut(s) 103, 394
HpyF3I CTNAG 1 cut(s) 615
Hsp92II CATG 9 cut(s) 143, 148, 275, 394, 401, 422, 437, 473, 515
Kzo9I GATC 3 cut(s) 124, 387, 508
LmnI GCTCC 3 cut(s) 92, 196, 526
LpnPI CCDG 3 cut(s) 31, 293, 615
LweI GCATC 2 cut(s) 460, 481
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 2 cut(s) 405, 441
MalI GATC 3 cut(s) 126, 389, 510
MboI GATC 3 cut(s) 124, 387, 508
MboII GAAGA 3 cut(s) 95, 473, 600
MluCI AATT 1 cut(s) 61
MlyI GAGTC 3 cut(s) 269, 305, 314
MnlI CCTC 5 cut(s) 211, 220, 277, 541, 550
MseI TTAA 1 cut(s) 516
NdeII GATC 3 cut(s) 124, 387, 508
NlaIII CATG 9 cut(s) 143, 148, 275, 394, 401, 422, 437, 473, 515
NlaIV GGNNCC 2 cut(s) 57, 522
NmuCI GTSAC 2 cut(s) 405, 441
NspI RCATGY 1 cut(s) 148
PaeI GCATGC 1 cut(s) 148
PagI TCATGA 2 cut(s) 418, 433
PfeI GAWTC 2 cut(s) 8, 574
Pfl23II CGTACG 1 cut(s) 149
PflFI GACNNNGTC 2 cut(s) 182, 259
PleI GAGTC 3 cut(s) 268, 304, 314
PpsI GAGTC 3 cut(s) 268, 304, 314
PspFI CCCAGC 1 cut(s) 17
PspLI CGTACG 1 cut(s) 149
PspN4I GGNNCC 2 cut(s) 57, 522
PsyI GACNNNGTC 2 cut(s) 182, 259
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SaqAI TTAA 1 cut(s) 516
Sau3AI GATC 3 cut(s) 124, 387, 508
SchI GAGTC 3 cut(s) 269, 305, 314
SetI ASST 6 cut(s) 34, 61, 193, 417, 616, 628
SfaNI GCATC 2 cut(s) 460, 481
SfcI CTRYAG 1 cut(s) 231
SphI GCATGC 1 cut(s) 148
Sse9I AATT 1 cut(s) 61
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 176
TaaI ACNGT 1 cut(s) 633
TaqI TCGA 4 cut(s) 299, 507, 555, 572
TasI AATT 1 cut(s) 61
TfiI GAWTC 2 cut(s) 8, 574
Tru1I TTAA 1 cut(s) 516
Tru9I TTAA 1 cut(s) 516
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 2 cut(s) 405, 441
Tsp45I GTSAC 2 cut(s) 405, 441
TspDTI ATGAA 3 cut(s) 177, 407, 566
TspGWI ACGGA 1 cut(s) 167
TspRI CASTG 1 cut(s) 112
Tth111I GACNNNGTC 2 cut(s) 182, 259
XceI RCATGY 1 cut(s) 148
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.