RchiOBHm_Chr3g0459511

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
7930322 .. 7930591
270 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42610

Sequence Viewer

Length: 261 bp
ATGTTGCATCACAAAGACGAATCAAATCACCATCACGAGGAAACTCATGGTTTGCGTAAAGACATTGATGAGAAGACCCCATTAGAGGAAGTTAAAGCTCCAAATGTGTTTGAGCGAGCAAAGGAGGAGTTCGAGGCTATAGTTGAAGCAATTCATTCCAAGAAGGAATCTGATTCGAGTGTTGAAATTAAAAAGGAGTCAAAGCAGGACAAAGCTGAATCAAAATCAGGTATTGATTTCATGACAATGTTGCTTATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.95

Weight (kDa)

5.45

Isoelectric Point (pI)

43.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 37, 85
AgsI TTSAA 2 cut(s) 146, 185
AluBI AGCT 2 cut(s) 98, 215
AluI AGCT 2 cut(s) 98, 215
Asp700I GAANNNNTTC 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 20
BauI CACGAG 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 80
BccI CCATC 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 138
BmsI GCATC 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 80
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 85
BseLI CCNNNNNNNGG 2 cut(s) 37, 85
BseRI GAGGAG 1 cut(s) 140
BslI CCNNNNNNNGG 2 cut(s) 37, 85
BspHI TCATGA 1 cut(s) 240
BssSI CACGAG 1 cut(s) 35
Bst2BI CACGAG 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 117
BstSFI CTRYAG 1 cut(s) 138
BstV2I GAAGAC 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 117
CciI TCATGA 1 cut(s) 240
CviAII CATG 2 cut(s) 47, 241
CviJI RGCY 3 cut(s) 98, 137, 215
CviKI_1 RGCY 3 cut(s) 98, 137, 215
FaeI CATG 2 cut(s) 50, 244
FaiI YATR 5 cut(s) 48, 140, 242, 257, 259
FatI CATG 2 cut(s) 46, 240
Hin1II CATG 2 cut(s) 50, 244
HinfI GANTC 5 cut(s) 20, 167, 173, 197, 218
HphI GGTGA 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 35, 241
HpyAV CCTTC 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 7
Hsp92II CATG 2 cut(s) 50, 244
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 2 cut(s) 191, 213
LweI GCATC 1 cut(s) 16
MboII GAAGA 1 cut(s) 85
MluCI AATT 2 cut(s) 150, 186
MlyI GAGTC 1 cut(s) 206
MnlI CCTC 4 cut(s) 31, 79, 118, 127
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 2 cut(s) 93, 189
MslI CAYNNNNRTG 1 cut(s) 245
NlaIII CATG 2 cut(s) 50, 244
PagI TCATGA 1 cut(s) 240
PdmI GAANNNNTTC 1 cut(s) 150
PfeI GAWTC 4 cut(s) 20, 167, 173, 218
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
RseI CAYNNNNRTG 1 cut(s) 245
SaqAI TTAA 2 cut(s) 93, 189
SchI GAGTC 1 cut(s) 206
SetI ASST 3 cut(s) 100, 217, 232
SfaNI GCATC 1 cut(s) 16
SfcI CTRYAG 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 245
Sse9I AATT 2 cut(s) 150, 186
TaqI TCGA 2 cut(s) 132, 176
TasI AATT 2 cut(s) 150, 186
TfiI GAWTC 4 cut(s) 20, 167, 173, 218
Tru1I TTAA 2 cut(s) 93, 189
Tru9I TTAA 2 cut(s) 93, 189
TspDTI ATGAA 2 cut(s) 143, 229
XmnI GAANNNNTTC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.