Rroxscaffold_2G00101470

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
23420492 .. 23421713
1222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00101470.1

Sequence Viewer

Length: 357 bp
ATGGCAGAACCAAAGCCAGAGCTCAAAGACTCTCTTTCAGGACATGACGCTGAGAAATCACCACAGCATGACAAAGAAACGCATGGAACGAGTGATGACATTGATGAGAACACCCCAATTGAAGAAGTGAAAGGACCAAGTGTGTTTGAAAGGGTGAAGGAAGAAGTTGAAGTTGAAGCCGTTGTGGAGGCGATAATTCACAAAGATTCCAGTAGCCATGACTCTTCTTCTAAGTGGGCAGAACTAGAAATTGTGGTTTGGCCAAGGTTTTACACTTTAATTCACCAGTTGGAATGTAAGATGTTGAACATTTCTTATGCTGTACCCATTAATTTCTTCTATACTTTAACTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.49

Weight (kDa)

4.7

Isoelectric Point (pI)

55.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 260
AfaI GTAC 1 cut(s) 324
AgsI TTSAA 5 cut(s) 122, 149, 170, 176, 307
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
Alw21I GWGCWC 1 cut(s) 24
AoxI GGCC 1 cut(s) 260
AseI ATTAAT 1 cut(s) 330
AspS9I GGNCC 1 cut(s) 134
AsuHPI GGTGA 3 cut(s) 51, 166, 275
AvaII GGWCC 1 cut(s) 134
BalI TGGCCA 1 cut(s) 262
BanII GRGCYC 1 cut(s) 24
Bbv12I GWGCWC 1 cut(s) 24
BceAI ACGGC 1 cut(s) 164
BfaI CTAG 2 cut(s) 245, 355
Bme18I GGWCC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 134
BsaJI CCNNGG 1 cut(s) 263
Bse1I ACTGG 2 cut(s) 210, 286
BseDI CCNNGG 1 cut(s) 263
BseMII CTCAG 1 cut(s) 42
BseNI ACTGG 2 cut(s) 210, 286
BshFI GGCC 1 cut(s) 262
BsiHKAI GWGCWC 1 cut(s) 24
BsnI GGCC 1 cut(s) 262
Bsp1286I GDGCHC 1 cut(s) 24
BspANI GGCC 1 cut(s) 262
BspCNI CTCAG 1 cut(s) 43
BsrI ACTGG 2 cut(s) 210, 286
BssECI CCNNGG 1 cut(s) 263
BssT1I CCWWGG 1 cut(s) 263
Bst6I CTCTTC 1 cut(s) 229
BstDEI CTNAG 2 cut(s) 51, 231
BsuRI GGCC 1 cut(s) 262
Cfr13I GGNCC 1 cut(s) 134
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 323
CviAII CATG 4 cut(s) 44, 68, 83, 218
CviJI RGCY 5 cut(s) 16, 22, 179, 216, 262
CviKI_1 RGCY 5 cut(s) 16, 22, 179, 216, 262
CviQI GTAC 1 cut(s) 323
DdeI CTNAG 2 cut(s) 51, 231
EaeI YGGCCR 1 cut(s) 260
Eam1104I CTCTTC 1 cut(s) 229
EarI CTCTTC 1 cut(s) 229
Ecl136II GAGCTC 1 cut(s) 22
Eco130I CCWWGG 1 cut(s) 263
Eco24I GRGCYC 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 134
Eco53kI GAGCTC 1 cut(s) 22
EcoICRI GAGCTC 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 263
EcoT38I GRGCYC 1 cut(s) 24
ErhI CCWWGG 1 cut(s) 263
FaeI CATG 4 cut(s) 47, 71, 86, 221
FaiI YATR 6 cut(s) 45, 69, 84, 219, 318, 342
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FatI CATG 4 cut(s) 43, 67, 82, 217
FriOI GRGCYC 1 cut(s) 24
FspBI CTAG 2 cut(s) 245, 355
HaeIII GGCC 1 cut(s) 262
HgaI GACGC 1 cut(s) 56
Hin1II CATG 4 cut(s) 47, 71, 86, 221
HinfI GANTC 3 cut(s) 29, 206, 221
HphI GGTGA 3 cut(s) 51, 166, 275
Hpy188III TCNNGA 1 cut(s) 39
HpyAV CCTTC 1 cut(s) 151
HpyF3I CTNAG 2 cut(s) 51, 231
Hsp92II CATG 4 cut(s) 47, 71, 86, 221
LpnPI CCDG 4 cut(s) 24, 30, 223, 299
MaeI CTAG 2 cut(s) 245, 355
MboII GAAGA 5 cut(s) 134, 173, 216, 219, 328
MfeI CAATTG 1 cut(s) 117
MhlI GDGCHC 1 cut(s) 24
MlsI TGGCCA 1 cut(s) 262
MluCI AATT 5 cut(s) 117, 195, 249, 279, 331
MluNI TGGCCA 1 cut(s) 262
MlyI GAGTC 2 cut(s) 23, 215
MmeI TCCRAC 1 cut(s) 270
MnlI CCTC 1 cut(s) 181
Mox20I TGGCCA 1 cut(s) 262
MscI TGGCCA 1 cut(s) 262
MseI TTAA 3 cut(s) 278, 330, 347
Msp20I TGGCCA 1 cut(s) 262
MunI CAATTG 1 cut(s) 117
NlaIII CATG 4 cut(s) 47, 71, 86, 221
PcsI WCGNNNNNNNCGW 1 cut(s) 86
PfeI GAWTC 1 cut(s) 206
PleI GAGTC 2 cut(s) 23, 215
PpsI GAGTC 2 cut(s) 23, 215
PshBI ATTAAT 1 cut(s) 330
Psp124BI GAGCTC 1 cut(s) 24
PspPI GGNCC 1 cut(s) 134
RsaI GTAC 1 cut(s) 324
RsaNI GTAC 1 cut(s) 323
SacI GAGCTC 1 cut(s) 24
SaqAI TTAA 3 cut(s) 278, 330, 347
Sau96I GGNCC 1 cut(s) 134
SchI GAGTC 2 cut(s) 23, 215
SduI GDGCHC 1 cut(s) 24
SetI ASST 2 cut(s) 24, 269
SinI GGWCC 1 cut(s) 134
Sse9I AATT 5 cut(s) 117, 195, 249, 279, 331
SspMI CTAG 2 cut(s) 245, 355
SstI GAGCTC 1 cut(s) 24
StyI CCWWGG 1 cut(s) 263
TasI AATT 5 cut(s) 117, 195, 249, 279, 331
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 3 cut(s) 278, 330, 347
Tru9I TTAA 3 cut(s) 278, 330, 347
VpaK11BI GGWCC 1 cut(s) 134
VspI ATTAAT 1 cut(s) 330
XspI CTAG 2 cut(s) 245, 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.