Rh2BG446200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
63095903 .. 63097997
2095 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG446200.1

Sequence Viewer

Length: 231 bp
ATGGCAGAACCAAAGCAAGAGCTGAAAGACTCTCTCTCAGGACATCACGCTGAGAAATCACCACATCATGACAAAGAAACGCATGGAACGAGTGATGACATTGATGAAAACACCCCAATTGAGGAAGTGAAAGGACCAAATGTGTTTGAAAGAGTGAAGGAAGAAGTCGAAGCCATTGTGGAGGCGATAATTCACAAAGATTCCAGTAGCCATGACTCTTCTTCTAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.46

Weight (kDa)

4.96

Isoelectric Point (pI)

53.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 149
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 51
AvaII GGWCC 1 cut(s) 134
Bme18I GGWCC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 121
BseMII CTCAG 2 cut(s) 42, 51
BseNI ACTGG 1 cut(s) 204
BslI CCNNNNNNNGG 1 cut(s) 121
BspCNI CTCAG 2 cut(s) 43, 50
BspHI TCATGA 1 cut(s) 67
BsrI ACTGG 1 cut(s) 204
Bst6I CTCTTC 1 cut(s) 223
BstDEI CTNAG 3 cut(s) 37, 51, 225
CciI TCATGA 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 134
CviAII CATG 3 cut(s) 68, 83, 212
CviJI RGCY 3 cut(s) 22, 173, 210
CviKI_1 RGCY 3 cut(s) 22, 173, 210
DdeI CTNAG 3 cut(s) 37, 51, 225
Eam1104I CTCTTC 1 cut(s) 223
EarI CTCTTC 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 134
FaeI CATG 3 cut(s) 71, 86, 215
FaiI YATR 3 cut(s) 69, 84, 213
FatI CATG 3 cut(s) 67, 82, 211
Hin1II CATG 3 cut(s) 71, 86, 215
HinfI GANTC 3 cut(s) 29, 200, 215
HphI GGTGA 1 cut(s) 51
Hpy188III TCNNGA 2 cut(s) 39, 68
HpyAV CCTTC 1 cut(s) 151
HpyF3I CTNAG 3 cut(s) 37, 51, 225
Hsp92II CATG 3 cut(s) 71, 86, 215
LpnPI CCDG 2 cut(s) 24, 217
MboII GAAGA 3 cut(s) 173, 210, 213
MfeI CAATTG 1 cut(s) 117
MluCI AATT 2 cut(s) 117, 189
MlyI GAGTC 2 cut(s) 23, 209
MnlI CCTC 2 cut(s) 115, 175
MunI CAATTG 1 cut(s) 117
NlaIII CATG 3 cut(s) 71, 86, 215
PagI TCATGA 1 cut(s) 67
PcsI WCGNNNNNNNCGW 1 cut(s) 86
PfeI GAWTC 1 cut(s) 200
PleI GAGTC 2 cut(s) 23, 209
PpsI GAGTC 2 cut(s) 23, 209
PspPI GGNCC 1 cut(s) 134
Sau96I GGNCC 1 cut(s) 134
SchI GAGTC 2 cut(s) 23, 209
SetI ASST 1 cut(s) 24
SgeI CNNG 8 cut(s) 29, 51, 59, 80, 95, 102, 216, 224
SinI GGWCC 1 cut(s) 134
Sse9I AATT 2 cut(s) 117, 189
TaqI TCGA 1 cut(s) 168
TasI AATT 2 cut(s) 117, 189
TfiI GAWTC 1 cut(s) 200
TspDTI ATGAA 1 cut(s) 120
VpaK11BI GGWCC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.