AT1G72690

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
27361146 .. 27361958
813 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G72690.1

Sequence Viewer

Length: 264 bp
ATGGCGGATCAAAACCGATCAGAGGAGAAGACTGTGAAATCGCCAAATGTGTTTGAACGAGTTAAAGAAGAAATAGAGGCAATGGGTCATCATGAAAAGTCCAAGAGTCGTCACCATGACAAAGAGACTCATGGAACAAGTGACGACATTGATGAGAGCACTCCAATTGATTATGTGAAAGGACCTGGTTTCTTTCAACGACTGAAAGAAGAGATTGAAGCTATCTTTAATGCTGTTACTCCCAAGCGTTCTTCAAAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.02

Weight (kDa)

6.2

Isoelectric Point (pI)

59.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 4 cut(s) 56, 197, 218, 255
AjnI CCWGG 1 cut(s) 184
AluBI AGCT 1 cut(s) 221
AluI AGCT 1 cut(s) 221
Alw21I GWGCWC 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 119
AlwI GGATC 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 1 cut(s) 182
BbsI GAAGAC 1 cut(s) 35
Bbv12I GWGCWC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BmrFI CCNGG 1 cut(s) 186
BpiI GAAGAC 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse3DI GCAATG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 186
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 87
BseRI GAGGAG 1 cut(s) 38
BsiHKAI GWGCWC 1 cut(s) 161
BslI CCNNNNNNNGG 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 161
Bsp143I GATC 2 cut(s) 7, 17
BspACI CCGC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 91
BspPI GGATC 1 cut(s) 15
BsrDI GCAATG 1 cut(s) 87
BssMI GATC 2 cut(s) 7, 17
Bst2UI CCWGG 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 34
Bst6I CTCTTC 1 cut(s) 204
BstKTI GATC 2 cut(s) 10, 20
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 2 cut(s) 7, 17
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstV2I GAAGAC 1 cut(s) 35
CciI TCATGA 1 cut(s) 91
Cfr13I GGNCC 1 cut(s) 182
CsiI ACCWGGT 1 cut(s) 184
CviAII CATG 3 cut(s) 92, 116, 131
CviJI RGCY 1 cut(s) 221
CviKI_1 RGCY 1 cut(s) 221
DpnI GATC 2 cut(s) 9, 19
DpnII GATC 2 cut(s) 7, 17
Eam1104I CTCTTC 1 cut(s) 204
EarI CTCTTC 1 cut(s) 204
EciI GGCGGA 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 182
EcoO109I RGGNCCY 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 3 cut(s) 95, 119, 134
FaiI YATR 4 cut(s) 93, 117, 132, 174
FatI CATG 3 cut(s) 91, 115, 130
Hin1II CATG 3 cut(s) 95, 119, 134
HinfI GANTC 2 cut(s) 106, 127
HphI GGTGA 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 92
HpyCH4III ACNGT 1 cut(s) 34
Hsp92II CATG 3 cut(s) 95, 119, 134
Kzo9I GATC 2 cut(s) 7, 17
LpnPI CCDG 2 cut(s) 171, 198
MabI ACCWGGT 1 cut(s) 184
MaeIII GTNAC 3 cut(s) 110, 140, 235
MalI GATC 2 cut(s) 9, 19
MboI GATC 2 cut(s) 7, 17
MboII GAAGA 4 cut(s) 40, 80, 221, 243
MfeI CAATTG 1 cut(s) 165
MhlI GDGCHC 1 cut(s) 161
MluCI AATT 1 cut(s) 165
MlyI GAGTC 2 cut(s) 115, 121
MnlI CCTC 2 cut(s) 16, 70
MseI TTAA 2 cut(s) 63, 228
MspR9I CCNGG 1 cut(s) 186
MunI CAATTG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 186
NdeII GATC 2 cut(s) 7, 17
NlaIII CATG 3 cut(s) 95, 119, 134
NmuCI GTSAC 2 cut(s) 110, 140
PagI TCATGA 1 cut(s) 91
PleI GAGTC 2 cut(s) 114, 121
PpsI GAGTC 2 cut(s) 114, 121
PpuMI RGGWCCY 1 cut(s) 182
Psp5II RGGWCCY 1 cut(s) 182
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspPI GGNCC 1 cut(s) 182
PspPPI RGGWCCY 1 cut(s) 182
SaqAI TTAA 2 cut(s) 63, 228
Sau3AI GATC 2 cut(s) 7, 17
Sau96I GGNCC 1 cut(s) 182
SchI GAGTC 2 cut(s) 115, 121
ScrFI CCNGG 1 cut(s) 186
SduI GDGCHC 1 cut(s) 161
SetI ASST 2 cut(s) 187, 223
SexAI ACCWGGT 1 cut(s) 184
SgeI CNNG 9 cut(s) 71, 104, 115, 128, 143, 150, 197, 198, 256
SinI GGWCC 1 cut(s) 182
Sse9I AATT 1 cut(s) 165
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 184
TaaI ACNGT 1 cut(s) 34
TasI AATT 1 cut(s) 165
Tru1I TTAA 2 cut(s) 63, 228
Tru9I TTAA 2 cut(s) 63, 228
TseFI GTSAC 2 cut(s) 110, 140
Tsp45I GTSAC 2 cut(s) 110, 140
TspDTI ATGAA 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.