AT1G43790

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0013267
Physical Location & Seq
Forward (+)
16575759 .. 16576541
783 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G43790.1

Sequence Viewer

Length: 351 bp
ATGGCCTCCACGGATTCAGTTTACCGTCCCACACCAACTCCAGACCATGACACTACTGTTGTAGTAGTTGTGTTTGTTTCTTTGGGTTGTGTCATGTTCTTGGCGTTTCTAGCGTTTGTTATCTGGTTCTTGATCAAGAAGAGATCCAGGAAGCACCGTGAGAGATCTGAAGCGGTTCGCGTGGATGAACACTTTAAGATGAAGGAAGCTATAGTCGAAGGACCTAATGGACAAAAGTCTGTGGTGTTATCAGTTGAGGATGATGTTAAGATCGAAGACGCGATCAAGAGAGAAGAGAAAGATCTGAAGAAAGATGGTGGAGTTGGATCATCAGTCGTTTCCCGTTCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.01

Weight (kDa)

7.88

Isoelectric Point (pI)

36.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013267)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G43790
fragaria_vesca FvH4_2g14670
malus_domestica MD05G1014900.v1.1 MD10G1014900.v1.1
prunus_persica Prupe.8G018800_v2.0.a1
pyrus_communis pycom05g00820 pycom10g00920
rosa_chinensis RchiOBHm_Chr6g0277141
rosa_laevigata RLG00000013328
rosa_multiflora Rmu_sc0003539.1_g000022 Rmu_sc0006244.1_g000041
rosa_roxburghii Rroxscaffold_7G00191570
rosa_rugosa Rorug06G0106500
rosa_samantha Rh6AG217300 Rh6BG221300 Rh6CG224200 Rh6DG213900
rosa_wichuraiana Rw6G018970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 180, 281
AciI CCGC 1 cut(s) 173
AclWI GGATC 2 cut(s) 138, 334
AcuI CTGAAG 2 cut(s) 189, 326
AjnI CCWGG 1 cut(s) 146
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
AlwI GGATC 2 cut(s) 138, 334
AoxI GGCC 1 cut(s) 3
Asp700I GAANNNNTTC 1 cut(s) 174
AspS9I GGNCC 1 cut(s) 221
AvaII GGWCC 1 cut(s) 221
BbsI GAAGAC 1 cut(s) 282
BccI CCATC 1 cut(s) 308
BciT130I CCWGG 1 cut(s) 148
BclI TGATCA 1 cut(s) 132
BfaI CTAG 1 cut(s) 110
BfmI CTRYAG 1 cut(s) 210
BglII AGATCT 2 cut(s) 164, 301
Bme1390I CCNGG 1 cut(s) 148
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 148
BoxI GACNNNNGTC 1 cut(s) 235
BpiI GAAGAC 1 cut(s) 282
BpmI CTGGAG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 22, 52
BseBI CCWGG 1 cut(s) 148
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 2 cut(s) 190, 265
Bsh1236I CGCG 2 cut(s) 180, 281
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 12
BsmFI GGGAC 1 cut(s) 12
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
BspACI CCGC 1 cut(s) 173
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 2 cut(s) 180, 281
BspPI GGATC 2 cut(s) 138, 334
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
Bst2UI CCWGG 1 cut(s) 148
Bst4CI ACNGT 3 cut(s) 26, 58, 158
Bst6I CTCTTC 2 cut(s) 134, 288
BstDSI CCRYGG 1 cut(s) 9
BstF5I GGATG 2 cut(s) 190, 265
BstFNI CGCG 2 cut(s) 180, 281
BstKTI GATC 7 cut(s) 135, 146, 167, 273, 285, 304, 329
BstMBI GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 148
BstPAI GACNNNNGTC 1 cut(s) 235
BstSCI CCNGG 1 cut(s) 146
BstSFI CTRYAG 1 cut(s) 210
BstUI CGCG 2 cut(s) 180, 281
BstV2I GAAGAC 1 cut(s) 282
BstX2I RGATCY 3 cut(s) 143, 164, 301
BstYI RGATCY 3 cut(s) 143, 164, 301
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 9
BtsCI GGATG 2 cut(s) 190, 265
Cfr13I GGNCC 1 cut(s) 221
CseI GACGC 1 cut(s) 287
CviAII CATG 2 cut(s) 47, 94
CviJI RGCY 2 cut(s) 5, 209
CviKI_1 RGCY 2 cut(s) 5, 209
DpnI GATC 7 cut(s) 134, 145, 166, 272, 284, 303, 328
DpnII GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
Eam1104I CTCTTC 2 cut(s) 134, 288
EarI CTCTTC 2 cut(s) 134, 288
Eco47I GGWCC 1 cut(s) 221
Eco57I CTGAAG 2 cut(s) 189, 326
EcoO109I RGGNCCY 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 146
FaeI CATG 2 cut(s) 50, 97
FaiI YATR 3 cut(s) 48, 95, 212
FaqI GGGAC 1 cut(s) 12
FatI CATG 2 cut(s) 46, 93
FbaI TGATCA 1 cut(s) 132
FokI GGATG 2 cut(s) 197, 272
FspBI CTAG 1 cut(s) 110
GsuI CTGGAG 1 cut(s) 24
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 287
Hin1II CATG 2 cut(s) 50, 97
HinfI GANTC 1 cut(s) 14
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 169, 306
Hpy188III TCNNGA 5 cut(s) 41, 130, 136, 286, 348
Hpy8I GTNNAC 1 cut(s) 22
HpyAV CCTTC 2 cut(s) 196, 212
HpyCH4III ACNGT 3 cut(s) 26, 58, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 2 cut(s) 50, 97
Ksp22I TGATCA 1 cut(s) 132
Kzo9I GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
LpnPI CCDG 4 cut(s) 54, 109, 133, 160
MaeI CTAG 1 cut(s) 110
MalI GATC 7 cut(s) 134, 145, 166, 272, 284, 303, 328
MboI GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
MboII GAAGA 4 cut(s) 151, 287, 305, 319
MflI RGATCY 3 cut(s) 143, 164, 301
MmeI TCCRAC 1 cut(s) 304
MnlI CCTC 2 cut(s) 16, 250
MroXI GAANNNNTTC 1 cut(s) 174
MseI TTAA 2 cut(s) 195, 267
MspR9I CCNGG 1 cut(s) 148
MvaI CCWGG 1 cut(s) 148
MvnI CGCG 2 cut(s) 180, 281
MwoI GCNNNNNNNGC 1 cut(s) 110
NdeII GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
NlaIII CATG 2 cut(s) 50, 97
PdmI GAANNNNTTC 1 cut(s) 174
PfeI GAWTC 1 cut(s) 14
PfoI TCCNGGA 1 cut(s) 146
PpuMI RGGWCCY 1 cut(s) 221
PshAI GACNNNNGTC 1 cut(s) 235
Psp5II RGGWCCY 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 146
PspGI CCWGG 1 cut(s) 146
PspPI GGNCC 1 cut(s) 221
PspPPI RGGWCCY 1 cut(s) 221
PsuI RGATCY 3 cut(s) 143, 164, 301
SaqAI TTAA 2 cut(s) 195, 267
Sau3AI GATC 7 cut(s) 132, 143, 164, 270, 282, 301, 326
Sau96I GGNCC 1 cut(s) 221
ScrFI CCNGG 1 cut(s) 148
SetI ASST 2 cut(s) 211, 226
SfcI CTRYAG 1 cut(s) 210
SinI GGWCC 1 cut(s) 221
SsiI CCGC 1 cut(s) 173
SspMI CTAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 146
TaaI ACNGT 3 cut(s) 26, 58, 158
TaqI TCGA 2 cut(s) 216, 273
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 2 cut(s) 195, 267
Tru9I TTAA 2 cut(s) 195, 267
TspDTI ATGAA 2 cut(s) 201, 215
TspGWI ACGGA 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 221
XmnI GAANNNNTTC 1 cut(s) 174
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.