AT2G21110

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0006333
Physical Location & Seq
Reverse (-)
9050220 .. 9050868
649 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G21110.1

Sequence Viewer

Length: 561 bp
ATGGGGAAGAATTTAGGATTAGTAGTTAGTTTTTATCTTTGCATCACGTTCGCACTCGGCGAATACTTTTCAGAAACTCGTCCAATCACACCGAAACAACTAGTGGTCACAAATCTCCATTTCTTCTTTCACGACACTCTCACCGCTCCAAACCCATCAGCCATCCTCATTGCCAAGCCTACTCACACAAGAGGAGACAACGACTCTTCTCCCTCACCTTTCGGTTCTCTTTTTGCTCTCGACGACCCTCTCACCGTTGGACCAGACCCGAAATCCGAGAAGATCGGGAACGCTAGAGGGATGTACGTTTCCTCTGGAAAACATGTCCCCACGTTGACCATGTACGTCGACTTCGGGTTCACATCGGGCAAGTTTAACGGTAGTTCTATAGCCGTGTTTTCGAGGAATACGATAACGGAGAAAGAGAGGGAGGTTGCAGTTGTGGGAGGCCGAGGAAGGTTTAGGATGGCTAGAGGAGTGGCTCAACTCAATACATATTACGTTAACTTGACCAATGGGGATGCTATCGTTGAGTACAATGTCACTCTCTATCATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

186

Amino Acids

20.43

Weight (kDa)

8.65

Isoelectric Point (pI)

27.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 36 - 183 8.4e-51 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 146
AccI GTMKAC 1 cut(s) 348
AciI CCGC 1 cut(s) 144
AcsI RAATTY 1 cut(s) 10
AfaI GTAC 3 cut(s) 305, 344, 536
AflIII ACRYGT 1 cut(s) 322
AhlI ACTAGT 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 189
AoxI GGCC 1 cut(s) 448
ApoI RAATTY 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 260
AsuHPI GGTGA 3 cut(s) 133, 207, 244
AvaII GGWCC 1 cut(s) 260
BarI GAAGNNNNNNTAC 2 cut(s) 335, 367
BccI CCATC 3 cut(s) 163, 170, 460
BceAI ACGGC 1 cut(s) 377
BcgI CGANNNNNNTGC 2 cut(s) 31, 65
BcoDI GTCTC 1 cut(s) 189
BcuI ACTAGT 1 cut(s) 100
BfaI CTAG 3 cut(s) 101, 294, 471
BfmI CTRYAG 1 cut(s) 387
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BmsI GCATC 2 cut(s) 51, 511
BsaJI CCNNGG 1 cut(s) 451
Bse3DI GCAATG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 451
BseGI GGATG 4 cut(s) 162, 306, 471, 526
BseMI GCAATG 1 cut(s) 168
BseRI GAGGAG 2 cut(s) 207, 489
BshFI GGCC 1 cut(s) 450
BslFI GGGAC 1 cut(s) 311
BsmAI GTCTC 1 cut(s) 189
BsmFI GGGAC 1 cut(s) 311
BsnI GGCC 1 cut(s) 450
Bsp143I GATC 1 cut(s) 282
BspACI CCGC 1 cut(s) 144
BspANI GGCC 1 cut(s) 450
BsrBI CCGCTC 1 cut(s) 146
BsrDI GCAATG 1 cut(s) 168
BssECI CCNNGG 1 cut(s) 451
BssMI GATC 1 cut(s) 282
Bst4CI ACNGT 2 cut(s) 256, 380
Bst6I CTCTTC 1 cut(s) 211
BstF5I GGATG 4 cut(s) 162, 306, 471, 526
BstKTI GATC 1 cut(s) 285
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 1 cut(s) 282
BstNSI RCATGY 1 cut(s) 326
BstSFI CTRYAG 1 cut(s) 387
BsuRI GGCC 1 cut(s) 450
BtsCI GGATG 4 cut(s) 162, 306, 471, 526
Cfr13I GGNCC 1 cut(s) 260
Csp6I GTAC 3 cut(s) 304, 343, 535
CviAII CATG 2 cut(s) 323, 340
CviJI RGCY 6 cut(s) 161, 178, 392, 450, 470, 482
CviKI_1 RGCY 6 cut(s) 161, 178, 392, 450, 470, 482
CviQI GTAC 3 cut(s) 304, 343, 535
DpnI GATC 1 cut(s) 284
DpnII GATC 1 cut(s) 282
Eam1104I CTCTTC 1 cut(s) 211
EarI CTCTTC 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 260
FaeI CATG 2 cut(s) 326, 343
FaiI YATR 4 cut(s) 324, 341, 389, 496
FaqI GGGAC 1 cut(s) 311
FatI CATG 2 cut(s) 322, 339
FblI GTMKAC 1 cut(s) 348
FokI GGATG 4 cut(s) 149, 313, 478, 533
FspBI CTAG 3 cut(s) 101, 294, 471
HaeIII GGCC 1 cut(s) 450
Hin1II CATG 2 cut(s) 326, 343
HincII GTYRAC 3 cut(s) 336, 349, 505
HindII GTYRAC 3 cut(s) 336, 349, 505
HinfI GANTC 1 cut(s) 203
HpaI GTTAAC 1 cut(s) 505
HphI GGTGA 3 cut(s) 133, 207, 244
Hpy166II GTNNAC 4 cut(s) 336, 349, 360, 505
Hpy188I TCNGA 2 cut(s) 73, 277
Hpy188III TCNNGA 4 cut(s) 131, 239, 286, 315
Hpy8I GTNNAC 4 cut(s) 336, 349, 360, 505
Hpy99I CGWCG 2 cut(s) 245, 350
HpyAV CCTTC 1 cut(s) 450
HpyCH4III ACNGT 2 cut(s) 256, 380
HpyCH4IV ACGT 5 cut(s) 47, 306, 332, 345, 501
HpyCH4V TGCA 2 cut(s) 42, 437
HpySE526I ACGT 5 cut(s) 47, 306, 332, 345, 501
Hsp92II CATG 2 cut(s) 326, 343
KspAI GTTAAC 1 cut(s) 505
Kzo9I GATC 1 cut(s) 282
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 276, 300
LweI GCATC 2 cut(s) 51, 511
MaeI CTAG 3 cut(s) 101, 294, 471
MaeII ACGT 5 cut(s) 47, 306, 332, 345, 501
MaeIII GTNAC 2 cut(s) 106, 541
MalI GATC 1 cut(s) 284
MbiI CCGCTC 1 cut(s) 146
MboI GATC 1 cut(s) 282
MboII GAAGA 4 cut(s) 19, 115, 198, 292
MluCI AATT 1 cut(s) 10
MlyI GAGTC 1 cut(s) 197
MmeI TCCRAC 1 cut(s) 238
MseI TTAA 3 cut(s) 375, 504, 559
NdeII GATC 1 cut(s) 282
NlaIII CATG 2 cut(s) 326, 343
NmeAIII GCCGAG 2 cut(s) 36, 476
NmuCI GTSAC 2 cut(s) 106, 541
NspI RCATGY 1 cut(s) 326
PciI ACATGT 1 cut(s) 322
PcsI WCGNNNNNNNCGW 2 cut(s) 57, 407
PleI GAGTC 1 cut(s) 197
PpsI GAGTC 1 cut(s) 197
PscI ACATGT 1 cut(s) 322
PspPI GGNCC 1 cut(s) 260
RsaI GTAC 3 cut(s) 305, 344, 536
RsaNI GTAC 3 cut(s) 304, 343, 535
SalI GTCGAC 1 cut(s) 347
SaqAI TTAA 3 cut(s) 375, 504, 559
Sau3AI GATC 1 cut(s) 282
Sau96I GGNCC 1 cut(s) 260
SchI GAGTC 1 cut(s) 197
SetI ASST 8 cut(s) 50, 220, 309, 335, 348, 435, 461, 504
SfaNI GCATC 2 cut(s) 51, 511
SfcI CTRYAG 1 cut(s) 387
SinI GGWCC 1 cut(s) 260
SpeI ACTAGT 1 cut(s) 100
Sse9I AATT 1 cut(s) 10
SsiI CCGC 1 cut(s) 144
SspMI CTAG 3 cut(s) 101, 294, 471
TaaI ACNGT 2 cut(s) 256, 380
TaiI ACGT 5 cut(s) 50, 309, 335, 348, 504
TaqI TCGA 3 cut(s) 240, 348, 401
TasI AATT 1 cut(s) 10
TatI WGTACW 1 cut(s) 534
Tru1I TTAA 3 cut(s) 375, 504, 559
Tru9I TTAA 3 cut(s) 375, 504, 559
TseFI GTSAC 2 cut(s) 106, 541
Tsp45I GTSAC 2 cut(s) 106, 541
TspGWI ACGGA 1 cut(s) 431
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 1 cut(s) 10
XceI RCATGY 1 cut(s) 326
XmiI GTMKAC 1 cut(s) 348
XspI CTAG 3 cut(s) 101, 294, 471
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.