AT3G11600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0010896
Physical Location & Seq
Forward (+)
3667205 .. 3668303
1099 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G11600.1

Sequence Viewer

Length: 354 bp
ATGAGTCGGAGGAACAAGAACGGCCCTAAGCTCGAGCTGAGGCTGAATCTTTCGCCGCCTCCTTCTCAAGCCAGCCAGATGAGTCTTGTTCGATCACCAAACCGATCCAACACGACTTCACCAAGCTCATGCGTTTCATCTGAAACTAACCAGGAGGAGAACGAGACAATAACCTCAATGGTTCTTGTGGGTTGCCCTCGTTGCCTTATGTACGTTATGCTTTCTGATGATGACCCTAAATGTCCTAAATGCAAAAGCACCGTTCTTCTTGATTTCCTCCAAGAAAACGCTTTTGCCGCTACAACCGCTACCGCTGCCAATACCAGACGCAAGAAGAAGACCTGGTGGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.04

Weight (kDa)

9.33

Isoelectric Point (pI)

77.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn-ribbon_GIR1 PF24747 58 - 94 1.6e-28 GIR1-like zinc ribbon domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 56, 297, 306, 312
AclWI GGATC 1 cut(s) 99
AfaI GTAC 1 cut(s) 212
AjnI CCWGG 2 cut(s) 150, 341
AluBI AGCT 3 cut(s) 31, 37, 126
AluI AGCT 3 cut(s) 31, 37, 126
Alw26I GTCTC 1 cut(s) 158
AlwI GGATC 1 cut(s) 99
Ama87I CYCGRG 1 cut(s) 32
AoxI GGCC 1 cut(s) 22
ApeKI GCWGC 1 cut(s) 314
AspS9I GGNCC 1 cut(s) 23
AsuHPI GGTGA 2 cut(s) 87, 111
AvaI CYCGRG 1 cut(s) 32
BbsI GAAGAC 1 cut(s) 344
BbvCI CCTCAGC 1 cut(s) 38
BbvI GCAGC 1 cut(s) 301
BceAI ACGGC 1 cut(s) 37
BciT130I CCWGG 2 cut(s) 152, 343
BcoDI GTCTC 1 cut(s) 158
BisI GCNGC 3 cut(s) 56, 297, 315
BlsI GCNGC 3 cut(s) 57, 298, 316
Bme1390I CCNGG 2 cut(s) 152, 343
BmeT110I CYCGRG 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 2 cut(s) 152, 343
BpiI GAAGAC 1 cut(s) 344
Bpu10I CCTNAGC 2 cut(s) 27, 38
BpuEI CTTGAG 1 cut(s) 51
BseBI CCWGG 2 cut(s) 152, 343
BseMII CTCAG 1 cut(s) 29
BseRI GAGGAG 1 cut(s) 170
BseXI GCAGC 1 cut(s) 301
BshFI GGCC 1 cut(s) 24
BsiHKCI CYCGRG 1 cut(s) 32
BsmAI GTCTC 1 cut(s) 158
BsnI GGCC 1 cut(s) 24
BsoBI CYCGRG 1 cut(s) 32
Bsp143I GATC 2 cut(s) 92, 104
BspACI CCGC 4 cut(s) 56, 297, 306, 312
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 30
BspPI GGATC 1 cut(s) 99
BssMI GATC 2 cut(s) 92, 104
Bst2UI CCWGG 2 cut(s) 152, 343
Bst4CI ACNGT 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 2 cut(s) 27, 38
BstKTI GATC 2 cut(s) 95, 107
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 2 cut(s) 92, 104
BstMWI GCNNNNNNNGC 4 cut(s) 201, 296, 305, 314
BstNI CCWGG 2 cut(s) 152, 343
BstSCI CCNGG 2 cut(s) 150, 341
BstV1I GCAGC 1 cut(s) 301
BstV2I GAAGAC 1 cut(s) 344
BsuRI GGCC 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 23
CseI GACGC 1 cut(s) 336
CsiI ACCWGGT 1 cut(s) 341
Csp6I GTAC 1 cut(s) 211
CviAII CATG 1 cut(s) 129
CviJI RGCY 7 cut(s) 24, 31, 37, 43, 71, 75, 126
CviKI_1 RGCY 7 cut(s) 24, 31, 37, 43, 71, 75, 126
CviQI GTAC 1 cut(s) 211
DdeI CTNAG 2 cut(s) 27, 38
DpnI GATC 2 cut(s) 94, 106
DpnII GATC 2 cut(s) 92, 104
Eco88I CYCGRG 1 cut(s) 32
EcoRII CCWGG 2 cut(s) 150, 341
FaeI CATG 1 cut(s) 132
FaiI YATR 3 cut(s) 130, 209, 218
FatI CATG 1 cut(s) 128
Fnu4HI GCNGC 3 cut(s) 56, 297, 315
Fsp4HI GCNGC 3 cut(s) 56, 297, 315
GluI GCNGC 3 cut(s) 56, 297, 315
HaeIII GGCC 1 cut(s) 24
HgaI GACGC 1 cut(s) 336
Hin1II CATG 1 cut(s) 132
HinfI GANTC 3 cut(s) 4, 46, 82
HphI GGTGA 2 cut(s) 87, 111
Hpy188I TCNGA 3 cut(s) 9, 142, 226
Hpy188III TCNNGA 1 cut(s) 269
HpyAV CCTTC 1 cut(s) 72
HpyCH4III ACNGT 1 cut(s) 262
HpyCH4IV ACGT 1 cut(s) 213
HpyCH4V TGCA 1 cut(s) 252
HpyF10VI GCNNNNNNNGC 4 cut(s) 201, 296, 305, 314
HpyF3I CTNAG 2 cut(s) 27, 38
HpySE526I ACGT 1 cut(s) 213
Hsp92II CATG 1 cut(s) 132
Kzo9I GATC 2 cut(s) 92, 104
LpnPI CCDG 6 cut(s) 85, 89, 137, 164, 328, 337
Lsp1109I GCAGC 1 cut(s) 301
MabI ACCWGGT 1 cut(s) 341
MaeII ACGT 1 cut(s) 213
MalI GATC 2 cut(s) 94, 106
MboI GATC 2 cut(s) 92, 104
MboII GAAGA 3 cut(s) 257, 346, 349
MlyI GAGTC 2 cut(s) 13, 91
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 7 cut(s) 3, 33, 69, 148, 184, 207, 287
MspA1I CMGCKG 1 cut(s) 314
MspR9I CCNGG 2 cut(s) 152, 343
MvaI CCWGG 2 cut(s) 152, 343
MwoI GCNNNNNNNGC 4 cut(s) 201, 296, 305, 314
NdeII GATC 2 cut(s) 92, 104
NlaIII CATG 1 cut(s) 132
PaeR7I CTCGAG 1 cut(s) 32
PfeI GAWTC 1 cut(s) 46
PkrI GCNGC 3 cut(s) 57, 298, 316
PleI GAGTC 2 cut(s) 12, 90
PpsI GAGTC 2 cut(s) 12, 90
Psp6I CCWGG 2 cut(s) 150, 341
PspGI CCWGG 2 cut(s) 150, 341
PspPI GGNCC 1 cut(s) 23
PspXI VCTCGAGB 1 cut(s) 32
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
SatI GCNGC 3 cut(s) 56, 297, 315
Sau3AI GATC 2 cut(s) 92, 104
Sau96I GGNCC 1 cut(s) 23
SchI GAGTC 2 cut(s) 13, 91
ScrFI CCNGG 2 cut(s) 152, 343
SetI ASST 6 cut(s) 33, 39, 128, 176, 216, 344
SexAI ACCWGGT 1 cut(s) 341
Sfr274I CTCGAG 1 cut(s) 32
SlaI CTCGAG 1 cut(s) 32
SmlI CTYRAG 2 cut(s) 32, 66
SmoI CTYRAG 2 cut(s) 32, 66
SsiI CCGC 4 cut(s) 56, 297, 306, 312
StyD4I CCNGG 2 cut(s) 150, 341
TaaI ACNGT 1 cut(s) 262
TaiI ACGT 1 cut(s) 216
TaqI TCGA 2 cut(s) 33, 91
TauI GCSGC 2 cut(s) 58, 299
TfiI GAWTC 1 cut(s) 46
TseI GCWGC 1 cut(s) 314
TspDTI ATGAA 1 cut(s) 126
XhoI CTCGAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.