Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0009261

Physical Location & Seq

Genomic Coordinates Reverse (-)

7463834 .. 7465975

Gene Structure 2142 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT3G21260.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 435 bp

ATGTGGGAATCTGATCCTCTTGTGTACTCAAATTTAGTTGAGATACTGAGAAAAGAAGCCAAGGAGGGATCCTCTAGGAAACCTAAAAGTTGTAGTAGAGCTGCTCTTTGGCTAACGAGAGCGATGGATTTTACATTGGCGCTATTGCAACGGCTGGTGAAAGACATGTCACAAAACATGGAACAAGCCATAGAAGAATGTTATAATTTGACTATAAAACCATGGCATGGATGGATCTCTTCTGCTGCTTTTAAGGTGGCTCTTAAACTGGTTCCAAACAACAACACATTCATCAATGTGCTTGCGGCGAAAGACGAGACACACCAAATGGTCCAAGATGATATTACAAGTCTAATTTCGTTGCTCATTCCACTTCTAAGCCAACTCCATTCTATTTTGGAATTATACGAAGTGAGCAAATTAAAGTCACCGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005488 GO:0005543 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005794 GO:0005802 GO:0006810 GO:0006869 GO:0008150 GO:0008289 GO:0010876 GO:0012505 GO:0017089 GO:0031974 GO:0031981 GO:0031984 GO:0032365 GO:0033036 GO:0033218 GO:0035091 GO:0035621 GO:0035627 GO:0042886 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0046625 GO:0046836 GO:0046907 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0051861 GO:0070013 GO:0070273 GO:0071702 GO:0071705 GO:0097001 GO:0097367 GO:0098791 GO:1901264 GO:1901981

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GLTP

Protein Analysis

144

Amino Acids

16.4

Weight (kDa)

6.83

Isoelectric Point (pI)

44.4

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
GLTP	PF08718	51 - 191	2.3e-41	Glycolipid transfer protein (GLTP)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009261)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21360 AT1G21360 AT1G21360 AT3G21260 AT3G21260 AT3G21260
fragaria_vesca	FvH4_2g14560
malus_domestica	MD05G1017200.v1.1 MD10G1017400.v1.1
prunus_persica	Prupe.8G021000_v2.0.a1
pyrus_communis	pycom10g01110
rosa_chinensis	RchiOBHm_Chr6g0276911
rosa_laevigata	RLG00000013355
rosa_multiflora	Rmu_sc0001425.1_g000018 Rmu_sc0003882.1_g000009
rosa_roxburghii	Rroxscaffold_7G00191800
rosa_rugosa	Rorug06G0104900
rosa_samantha	Rh6AG214800 Rh6BG219700 Rh6CG222300 Rh6DG212500
rosa_wichuraiana	Rw6G018790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	204
AccB7I	CCANNNNNTGG	1 cut(s)	227
AciI	CCGC	1 cut(s)	305
AclWI	GGATC	4 cut(s)	8, 63, 76, 242
AcsI	RAATTY	1 cut(s)	31
AfaI	GTAC	1 cut(s)	26
AfiI	CCNNNNNNNGG	1 cut(s)	227
AflIII	ACRYGT	1 cut(s)	165
AluBI	AGCT	1 cut(s)	101
AluI	AGCT	1 cut(s)	101
Alw26I	GTCTC	1 cut(s)	311
AlwI	GGATC	4 cut(s)	8, 63, 76, 242
ApeKI	GCWGC	2 cut(s)	101, 245
ApoI	RAATTY	1 cut(s)	31
AspLEI	GCGC	1 cut(s)	142
AspS9I	GGNCC	1 cut(s)	331
AsuHPI	GGTGA	2 cut(s)	169, 420
AvaII	GGWCC	1 cut(s)	331
BamHI	GGATCC	1 cut(s)	68
BbvI	GCAGC	2 cut(s)	88, 232
BccI	CCATC	2 cut(s)	118, 225
BceAI	ACGGC	1 cut(s)	167
BcoDI	GTCTC	1 cut(s)	311
BfaI	CTAG	1 cut(s)	75
BfoI	RGCGCY	1 cut(s)	143
BisI	GCNGC	3 cut(s)	102, 246, 306
BlsI	GCNGC	3 cut(s)	103, 247, 307
Bme18I	GGWCC	1 cut(s)	331
BmgT120I	GGNCC	1 cut(s)	331
BmiI	GGNNCC	2 cut(s)	70, 273
BplI	GAGNNNNNCTC	2 cut(s)	56, 88
BsaJI	CCNNGG	2 cut(s)	60, 221
Bsc4I	CCNNNNNNNGG	1 cut(s)	227
Bse1I	ACTGG	1 cut(s)	273
BseDI	CCNNGG	2 cut(s)	60, 221
BseGI	GGATG	1 cut(s)	236
BseLI	CCNNNNNNNGG	1 cut(s)	227
BseMII	CTCAG	1 cut(s)	38
BseNI	ACTGG	1 cut(s)	273
BseXI	GCAGC	2 cut(s)	88, 232
BslI	CCNNNNNNNGG	1 cut(s)	227
BsmAI	GTCTC	1 cut(s)	311
Bsp143I	GATC	3 cut(s)	13, 68, 234
Bsp19I	CCATGG	1 cut(s)	221
BspACI	CCGC	1 cut(s)	305
BspCNI	CTCAG	1 cut(s)	39
BspLI	GGNNCC	2 cut(s)	70, 273
BspPI	GGATC	4 cut(s)	8, 63, 76, 242
BsrI	ACTGG	1 cut(s)	273
BssECI	CCNNGG	2 cut(s)	60, 221
BssMI	GATC	3 cut(s)	13, 68, 234
BssT1I	CCWWGG	2 cut(s)	60, 221
Bst4CI	ACNGT	1 cut(s)	432
Bst6I	CTCTTC	1 cut(s)	244
BstC8I	GCNNGC	1 cut(s)	303
BstDEI	CTNAG	2 cut(s)	47, 377
BstDSI	CCRYGG	1 cut(s)	221
BstF5I	GGATG	1 cut(s)	236
BstH2I	RGCGCY	1 cut(s)	143
BstHHI	GCGC	1 cut(s)	142
BstKTI	GATC	3 cut(s)	16, 71, 237
BstMAI	GTCTC	1 cut(s)	311
BstMBI	GATC	3 cut(s)	13, 68, 234
BstNSI	RCATGY	1 cut(s)	169
BstV1I	GCAGC	2 cut(s)	88, 232
BstX2I	RGATCY	2 cut(s)	68, 234
BstYI	RGATCY	2 cut(s)	68, 234
BtgI	CCRYGG	1 cut(s)	221
BtgZI	GCGATG	1 cut(s)	137
BtsCI	GGATG	1 cut(s)	236
Cac8I	GCNNGC	1 cut(s)	303
CfoI	GCGC	1 cut(s)	142
Cfr13I	GGNCC	1 cut(s)	331
Csp6I	GTAC	1 cut(s)	25
CviAII	CATG	4 cut(s)	166, 178, 222, 227
CviJI	RGCY	7 cut(s)	59, 101, 112, 154, 188, 260, 381
CviKI_1	RGCY	7 cut(s)	59, 101, 112, 154, 188, 260, 381
CviQI	GTAC	1 cut(s)	25
DdeI	CTNAG	2 cut(s)	47, 377
DpnI	GATC	3 cut(s)	15, 70, 236
DpnII	GATC	3 cut(s)	13, 68, 234
Eam1104I	CTCTTC	1 cut(s)	244
EarI	CTCTTC	1 cut(s)	244
Eco130I	CCWWGG	2 cut(s)	60, 221
Eco47I	GGWCC	1 cut(s)	331
EcoT14I	CCWWGG	2 cut(s)	60, 221
ErhI	CCWWGG	2 cut(s)	60, 221
FaeI	CATG	4 cut(s)	169, 181, 225, 230
FaiI	YATR	8 cut(s)	167, 179, 191, 204, 215, 223, 228, 406
FatI	CATG	4 cut(s)	165, 177, 221, 226
Fnu4HI	GCNGC	3 cut(s)	102, 246, 306
FokI	GGATG	1 cut(s)	243
Fsp4HI	GCNGC	3 cut(s)	102, 246, 306
FspBI	CTAG	1 cut(s)	75
GlaI	GCGC	1 cut(s)	141
GluI	GCNGC	3 cut(s)	102, 246, 306
HaeII	RGCGCY	1 cut(s)	143
HhaI	GCGC	1 cut(s)	142
Hin1II	CATG	4 cut(s)	169, 181, 225, 230
Hin6I	GCGC	1 cut(s)	140
HinP1I	GCGC	1 cut(s)	140
HinfI	GANTC	1 cut(s)	8
HphI	GGTGA	2 cut(s)	169, 420
Hpy166II	GTNNAC	1 cut(s)	25
Hpy188I	TCNGA	1 cut(s)	13
Hpy8I	GTNNAC	1 cut(s)	25
HpyCH4III	ACNGT	1 cut(s)	432
HpyCH4V	TGCA	1 cut(s)	148
HpyF3I	CTNAG	2 cut(s)	47, 377
Hsp92II	CATG	4 cut(s)	169, 181, 225, 230
HspAI	GCGC	1 cut(s)	140
Kzo9I	GATC	3 cut(s)	13, 68, 234
LpnPI	CCDG	2 cut(s)	140, 254
Lsp1109I	GCAGC	2 cut(s)	88, 232
MaeI	CTAG	1 cut(s)	75
MaeIII	GTNAC	2 cut(s)	168, 426
MalI	GATC	3 cut(s)	15, 70, 236
MboI	GATC	3 cut(s)	13, 68, 234
MboII	GAAGA	2 cut(s)	206, 231
MflI	RGATCY	2 cut(s)	68, 234
MluCI	AATT	5 cut(s)	31, 205, 354, 401, 419
MnlI	CCTC	3 cut(s)	27, 58, 82
MseI	TTAA	3 cut(s)	252, 264, 422
MslI	CAYNNNNRTG	1 cut(s)	296
NcoI	CCATGG	1 cut(s)	221
NdeII	GATC	3 cut(s)	13, 68, 234
NlaIII	CATG	4 cut(s)	169, 181, 225, 230
NlaIV	GGNNCC	2 cut(s)	70, 273
NmuCI	GTSAC	2 cut(s)	168, 426
NspI	RCATGY	1 cut(s)	169
PciI	ACATGT	1 cut(s)	165
PfeI	GAWTC	1 cut(s)	8
PflMI	CCANNNNNTGG	1 cut(s)	227
PkrI	GCNGC	3 cut(s)	103, 247, 307
PscI	ACATGT	1 cut(s)	165
PsiI	TTATAA	1 cut(s)	204
PspN4I	GGNNCC	2 cut(s)	70, 273
PspPI	GGNCC	1 cut(s)	331
PsuI	RGATCY	2 cut(s)	68, 234
RsaI	GTAC	1 cut(s)	26
RsaNI	GTAC	1 cut(s)	25
RseI	CAYNNNNRTG	1 cut(s)	296
SaqAI	TTAA	3 cut(s)	252, 264, 422
SatI	GCNGC	3 cut(s)	102, 246, 306
Sau3AI	GATC	3 cut(s)	13, 68, 234
Sau96I	GGNCC	1 cut(s)	331
SetI	ASST	3 cut(s)	85, 103, 258
SinI	GGWCC	1 cut(s)	331
SmiMI	CAYNNNNRTG	1 cut(s)	296
Sse9I	AATT	5 cut(s)	31, 205, 354, 401, 419
SsiI	CCGC	1 cut(s)	305
SspMI	CTAG	1 cut(s)	75
StyI	CCWWGG	2 cut(s)	60, 221
TaaI	ACNGT	1 cut(s)	432
TasI	AATT	5 cut(s)	31, 205, 354, 401, 419
TatI	WGTACW	1 cut(s)	24
TauI	GCSGC	1 cut(s)	308
TfiI	GAWTC	1 cut(s)	8
Tru1I	TTAA	3 cut(s)	252, 264, 422
Tru9I	TTAA	3 cut(s)	252, 264, 422
TseFI	GTSAC	2 cut(s)	168, 426
TseI	GCWGC	2 cut(s)	101, 245
Tsp45I	GTSAC	2 cut(s)	168, 426
TspDTI	ATGAA	1 cut(s)	280
Van91I	CCANNNNNTGG	1 cut(s)	227
VpaK11BI	GGWCC	1 cut(s)	331
XapI	RAATTY	1 cut(s)	31
XceI	RCATGY	1 cut(s)	169
XcmI	CCANNNNNNNNNTGG	1 cut(s)	228
XspI	CTAG	1 cut(s)	75

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.