AT3G43503

Zinc knuckle (CCHC-type) family protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
15400717 .. 15401123
407 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G43503.1

Sequence Viewer

Length: 189 bp
ATGATTGCTATTAAGTACAACAGTGGGTCTAAAAGAGTTGTATGTTTAAGATGTGGAGACATTGGTCATGACATGATTTTGTGCAAAATATACAATGCTATATCTGTAAAAGCTTTGGCCATCTATGATGTGTCGAACCCGATGATTCAATGTCATGGGTTGTATCTTGCTACAAATGTGGTCAACTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.82

Weight (kDa)

8.8

Isoelectric Point (pI)

23.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 117
AfaI GTAC 1 cut(s) 17
AgsI TTSAA 1 cut(s) 149
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 51
AoxI GGCC 1 cut(s) 117
BalI TGGCCA 1 cut(s) 119
BccI CCATC 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 51
BfaI CTAG 1 cut(s) 187
BoxI GACNNNNGTC 1 cut(s) 63
BshFI GGCC 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 51
BsnI GGCC 1 cut(s) 119
BspANI GGCC 1 cut(s) 119
BspHI TCATGA 1 cut(s) 67
Bst4CI ACNGT 1 cut(s) 23
BstMAI GTCTC 1 cut(s) 51
BstPAI GACNNNNGTC 1 cut(s) 63
BsuRI GGCC 1 cut(s) 119
BtsIMutI CAGTG 1 cut(s) 28
CciI TCATGA 1 cut(s) 67
Csp6I GTAC 1 cut(s) 16
CviAII CATG 3 cut(s) 68, 73, 155
CviJI RGCY 2 cut(s) 113, 119
CviKI_1 RGCY 2 cut(s) 113, 119
CviQI GTAC 1 cut(s) 16
EaeI YGGCCR 1 cut(s) 117
FaeI CATG 3 cut(s) 71, 76, 158
FaiI YATR 7 cut(s) 43, 69, 74, 91, 101, 126, 156
FatI CATG 3 cut(s) 67, 72, 154
FspBI CTAG 1 cut(s) 187
HaeIII GGCC 1 cut(s) 119
Hin1II CATG 3 cut(s) 71, 76, 158
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HindIII AAGCTT 1 cut(s) 111
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 184
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 184
HpyCH4III ACNGT 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 84
Hsp92II CATG 3 cut(s) 71, 76, 158
MaeI CTAG 1 cut(s) 187
MlsI TGGCCA 1 cut(s) 119
MluNI TGGCCA 1 cut(s) 119
Mox20I TGGCCA 1 cut(s) 119
MscI TGGCCA 1 cut(s) 119
MseI TTAA 2 cut(s) 12, 47
Msp20I TGGCCA 1 cut(s) 119
NlaIII CATG 3 cut(s) 71, 76, 158
PagI TCATGA 1 cut(s) 67
PfeI GAWTC 1 cut(s) 145
PshAI GACNNNNGTC 1 cut(s) 63
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SaqAI TTAA 2 cut(s) 12, 47
SetI ASST 1 cut(s) 115
SgeI CNNG 5 cut(s) 80, 85, 151, 167, 179
SspMI CTAG 1 cut(s) 187
TaaI ACNGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 134
TatI WGTACW 1 cut(s) 15
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 2 cut(s) 12, 47
Tru9I TTAA 2 cut(s) 12, 47
TscAI CASTG 1 cut(s) 28
TspRI CASTG 1 cut(s) 28
XspI CTAG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.