AT4G05590

Mediates the uptake of pyruvate into mitochondria

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0005603
Physical Location & Seq
Forward (+)
2907012 .. 2908631
1620 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G05590.3

Sequence Viewer

Length: 327 bp
ATGGCAACTTCGAAGCTTCAAGCTCTTTGGAATCATCCAGCTGGACCTAAGACAATTCATTTTTGGGCGCCGACGTTCAAGTGGGGTATAAGCATTGCCAATATTGCAGACTTTCAAAAACCTCCAGAGACACTTTCATACCCTCAACAAATTGTGATCACAGGTACTGGACTTGTTTGGTCACGTTACAGCACTGTAATTACTCCGAAAAACTGGAATCTCTTTAGCGTGAGTCTTGGTATGGCTGTGACAGGGATATACCAACTTACTCGTAAAATAAAGCACGATTATGTATATGAAGCAAATTCTATTGTTGCAAAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MPC

Protein Analysis

108

Amino Acids

12.18

Weight (kDa)

9.65

Isoelectric Point (pI)

19.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MPC PF03650 6 - 69 2.5e-27 Mitochondrial pyruvate carriers
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 67
AcsI RAATTY 1 cut(s) 304
AcyI GRCGYC 1 cut(s) 68
AfaI GTAC 1 cut(s) 166
AgsI TTSAA 3 cut(s) 20, 79, 116
AluBI AGCT 3 cut(s) 16, 23, 41
AluI AGCT 3 cut(s) 16, 23, 41
Alw26I GTCTC 1 cut(s) 122
AlwNI CAGNNNCTG 1 cut(s) 167
ApoI RAATTY 1 cut(s) 304
AspLEI GCGC 1 cut(s) 70
AspS9I GGNCC 1 cut(s) 44
AsuII TTCGAA 1 cut(s) 11
AvaII GGWCC 1 cut(s) 44
BanI GGYRCC 1 cut(s) 67
BclI TGATCA 1 cut(s) 156
BcoDI GTCTC 1 cut(s) 122
BfoI RGCGCY 1 cut(s) 71
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 69
BpmI CTGGAG 1 cut(s) 108
Bpu14I TTCGAA 1 cut(s) 11
BsaHI GRCGYC 1 cut(s) 68
Bse1I ACTGG 2 cut(s) 172, 218
Bse3DI GCAATG 1 cut(s) 93
BseGI GGATG 1 cut(s) 34
BseMI GCAATG 1 cut(s) 93
BseNI ACTGG 2 cut(s) 172, 218
BshNI GGYRCC 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 122
Bsp119I TTCGAA 1 cut(s) 11
Bsp143I GATC 1 cut(s) 156
BspLI GGNNCC 1 cut(s) 69
BspT104I TTCGAA 1 cut(s) 11
BspT107I GGYRCC 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 93
BsrI ACTGG 2 cut(s) 172, 218
BssMI GATC 1 cut(s) 156
BssNI GRCGYC 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 196
BstACI GRCGYC 1 cut(s) 68
BstBI TTCGAA 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 1 cut(s) 34
BstH2I RGCGCY 1 cut(s) 71
BstHHI GCGC 1 cut(s) 70
BstKTI GATC 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 122
BstMBI GATC 1 cut(s) 156
BstMWI GCNNNNNNNGC 1 cut(s) 104
BtsCI GGATG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 192
CaiI CAGNNNCTG 1 cut(s) 167
CfoI GCGC 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 44
Csp6I GTAC 1 cut(s) 165
CviJI RGCY 4 cut(s) 16, 23, 41, 245
CviKI_1 RGCY 4 cut(s) 16, 23, 41, 245
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 1 cut(s) 48
DinI GGCGCC 1 cut(s) 69
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 44
EgeI GGCGCC 1 cut(s) 69
EheI GGCGCC 1 cut(s) 69
FaiI YATR 7 cut(s) 89, 139, 242, 259, 291, 295, 297
FbaI TGATCA 1 cut(s) 156
FokI GGATG 1 cut(s) 21
GlaI GCGC 1 cut(s) 69
GsuI CTGGAG 1 cut(s) 108
HaeII RGCGCY 1 cut(s) 71
HhaI GCGC 1 cut(s) 70
Hin1I GRCGYC 1 cut(s) 68
Hin6I GCGC 1 cut(s) 68
HinP1I GCGC 1 cut(s) 68
HindIII AAGCTT 1 cut(s) 14
HinfI GANTC 3 cut(s) 31, 217, 232
Hpy188I TCNGA 1 cut(s) 207
Hpy188III TCNNGA 1 cut(s) 125
Hpy99I CGWCG 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4IV ACGT 2 cut(s) 74, 184
HpyCH4V TGCA 2 cut(s) 107, 317
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 48
HpySE526I ACGT 2 cut(s) 74, 184
Hsp92I GRCGYC 1 cut(s) 68
HspAI GCGC 1 cut(s) 68
KasI GGCGCC 1 cut(s) 67
Ksp22I TGATCA 1 cut(s) 156
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 7 cut(s) 27, 51, 138, 147, 153, 199, 237
MaeII ACGT 2 cut(s) 74, 184
MaeIII GTNAC 3 cut(s) 180, 185, 247
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MluCI AATT 4 cut(s) 54, 150, 198, 304
Mly113I GGCGCC 1 cut(s) 68
MlyI GAGTC 1 cut(s) 241
MnlI CCTC 2 cut(s) 132, 153
MslI CAYNNNNRTG 1 cut(s) 288
MspA1I CMGCKG 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 104
NarI GGCGCC 1 cut(s) 68
NdeII GATC 1 cut(s) 156
NlaIV GGNNCC 1 cut(s) 69
NmuCI GTSAC 2 cut(s) 180, 247
NspV TTCGAA 1 cut(s) 11
PfeI GAWTC 2 cut(s) 31, 217
PleI GAGTC 1 cut(s) 240
PluTI GGCGCC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 240
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 44
PstNI CAGNNNCTG 1 cut(s) 167
PvuII CAGCTG 1 cut(s) 41
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
RseI CAYNNNNRTG 1 cut(s) 288
Sau3AI GATC 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 44
SchI GAGTC 1 cut(s) 241
SetI ASST 8 cut(s) 18, 25, 43, 49, 77, 124, 166, 187
SfoI GGCGCC 1 cut(s) 69
SfuI TTCGAA 1 cut(s) 11
SinI GGWCC 1 cut(s) 44
SmiMI CAYNNNNRTG 1 cut(s) 288
Sse9I AATT 4 cut(s) 54, 150, 198, 304
SspDI GGCGCC 1 cut(s) 67
SspI AATATT 1 cut(s) 103
TaaI ACNGT 1 cut(s) 196
TaiI ACGT 2 cut(s) 77, 187
TaqI TCGA 1 cut(s) 11
TasI AATT 4 cut(s) 54, 150, 198, 304
TfiI GAWTC 2 cut(s) 31, 217
TscAI CASTG 1 cut(s) 199
TseFI GTSAC 2 cut(s) 180, 247
Tsp45I GTSAC 2 cut(s) 180, 247
TspDTI ATGAA 3 cut(s) 47, 126, 312
TspRI CASTG 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 44
XapI RAATTY 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.