Prupe.3G207100_v2.0.a1

Mitochondrial pyruvate carrier

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
21376808 .. 21377202
395 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G207100.1

Sequence Viewer

Length: 117 bp
ATGGCTGCAACTTCCATGTTTCAACTTTCACGTAAAATTCAGCATGACTTATCTCCCAAAAACCAACAAGCTGCTGAAAAGAATAATGAAGAACATCACTTCATCAACTTATTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

39

Amino Acids

4.42

Weight (kDa)

6.82

Isoelectric Point (pI)

34.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 36
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
ApeKI GCWGC 2 cut(s) 5, 71
ApoI RAATTY 1 cut(s) 36
BbvI GCAGC 1 cut(s) 58
BisI GCNGC 2 cut(s) 6, 72
BlsI GCNGC 2 cut(s) 7, 73
BsaAI YACGTR 1 cut(s) 32
BseXI GCAGC 1 cut(s) 58
BstBAI YACGTR 1 cut(s) 32
BstV1I GCAGC 1 cut(s) 58
CviAII CATG 2 cut(s) 16, 44
CviJI RGCY 2 cut(s) 5, 71
CviKI_1 RGCY 2 cut(s) 5, 71
FaeI CATG 2 cut(s) 19, 47
FaiI YATR 3 cut(s) 17, 45, 115
FatI CATG 2 cut(s) 15, 43
Fnu4HI GCNGC 2 cut(s) 6, 72
Fsp4HI GCNGC 2 cut(s) 6, 72
FspEI CC 4 cut(s) 28, 69, 70, 77
GluI GCNGC 2 cut(s) 6, 72
Hin1II CATG 2 cut(s) 19, 47
HpyCH4IV ACGT 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 8
HpySE526I ACGT 1 cut(s) 31
Hsp92II CATG 2 cut(s) 19, 47
Lsp1109I GCAGC 1 cut(s) 58
MaeII ACGT 1 cut(s) 31
MboII GAAGA 1 cut(s) 101
MluCI AATT 1 cut(s) 36
NlaIII CATG 2 cut(s) 19, 47
PkrI GCNGC 2 cut(s) 7, 73
Ppu21I YACGTR 1 cut(s) 32
SatI GCNGC 2 cut(s) 6, 72
SetI ASST 2 cut(s) 34, 73
SgeI CNNG 4 cut(s) 28, 42, 56, 80
Sse9I AATT 1 cut(s) 36
TaiI ACGT 1 cut(s) 34
TasI AATT 1 cut(s) 36
TseI GCWGC 2 cut(s) 5, 71
TspDTI ATGAA 2 cut(s) 91, 102
XapI RAATTY 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.