AT5G19910

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0003842
Physical Location & Seq
Reverse (-)
6730978 .. 6732990
2013 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G19910.2

Sequence Viewer

Length: 591 bp
ATGGCTTCGCCAGAGGAGATGGGTGATGATGCATCAGAAATTCCATCCCCGCCAAAAAACACTTACAAGGATCCCGACGGTGGAAGGCAACGATTCTTACTGGAACTTGAATTTATTCAATGTCTCGCCAATCCTACTTACATCCACTACCTGGCACAGAATCGGTATTTTGAAGATGAAGCATTTATTGGATACTTGAAGTATCTTCAATACTGGCAGCGACCAGAGTACATCAAGTTCATTATGTACCCACACTGCCTATATTTCCTTGAACTTCTTCAAAACCCCAACTTCAGGACTGCTATGGCTCATCCTGCAAACAAGGAATTGGCGCATAGACAACAGTTTTACTATTGGAAGAACTACAGAAACAACAGACTGAAGCACATTCTACCTCGGCCTCTTCCAGAGCCTGTACCTCCACAACCACCAGTTGCACCTTCAACTTCTTTGCCACCTGCACCATCTGCAACTGCTGCTCTCTCTCCAGCCCTTTCTCCAATGCAGTACAATAATATGCTTTCTAAGAATGACACTAGGAATATGGGTGCTACTGGAATTGATCGTAGGAAGAGAAAGAAGGGTATATAA

Protein Analysis

196

Amino Acids

22.82

Weight (kDa)

9.24

Isoelectric Point (pI)

63.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med31 PF05669 30 - 106 7.7e-34 SOH1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 466
Acc36I ACCTGC 1 cut(s) 466
AccB7I CCANNNNNTGG 1 cut(s) 151
AciI CCGC 1 cut(s) 50
AclWI GGATC 2 cut(s) 65, 78
AcsI RAATTY 2 cut(s) 39, 110
AcuI CTGAAG 2 cut(s) 277, 401
AfaI GTAC 4 cut(s) 230, 248, 417, 509
AfiI CCNNNNNNNGG 3 cut(s) 80, 151, 294
AgsI TTSAA 8 cut(s) 110, 119, 173, 199, 209, 272, 281, 444
AjnI CCWGG 1 cut(s) 150
AjuI GAANNNNNNNTTGG 2 cut(s) 171, 203
Alw26I GTCTC 1 cut(s) 128
AlwI GGATC 2 cut(s) 65, 78
AlwNI CAGNNNCTG 1 cut(s) 413
AoxI GGCC 1 cut(s) 398
ApeKI GCWGC 2 cut(s) 217, 476
ApoI RAATTY 2 cut(s) 39, 110
Asp700I GAANNNNTTC 2 cut(s) 114, 276
AspLEI GCGC 1 cut(s) 334
AsuHPI GGTGA 1 cut(s) 35
BamHI GGATCC 1 cut(s) 70
BbvI GCAGC 2 cut(s) 229, 463
BccI CCATC 3 cut(s) 13, 52, 472
BciT130I CCWGG 1 cut(s) 152
BciVI GTATCC 1 cut(s) 185
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 537
BfmI CTRYAG 1 cut(s) 364
BfuAI ACCTGC 1 cut(s) 466
BfuI GTATCC 1 cut(s) 185
BisI GCNGC 2 cut(s) 218, 477
BlsI GCNGC 2 cut(s) 219, 478
Bme1390I CCNGG 1 cut(s) 152
BmiI GGNNCC 1 cut(s) 72
BmrFI CCNGG 1 cut(s) 152
BmsI GCATC 2 cut(s) 19, 41
BpmI CTGGAG 1 cut(s) 471
BsaJI CCNNGG 1 cut(s) 395
Bsc4I CCNNNNNNNGG 3 cut(s) 80, 151, 294
Bse1I ACTGG 4 cut(s) 105, 218, 431, 559
BseBI CCWGG 1 cut(s) 152
BseDI CCNNGG 1 cut(s) 395
BseGI GGATG 3 cut(s) 44, 141, 310
BseLI CCNNNNNNNGG 3 cut(s) 80, 151, 294
BseNI ACTGG 4 cut(s) 105, 218, 431, 559
BseRI GAGGAG 1 cut(s) 29
BseXI GCAGC 2 cut(s) 229, 463
BsgI GTGCAG 1 cut(s) 444
BshFI GGCC 1 cut(s) 400
BslI CCNNNNNNNGG 3 cut(s) 80, 151, 294
BsmAI GTCTC 1 cut(s) 128
BsnI GGCC 1 cut(s) 400
Bsp143I GATC 2 cut(s) 70, 562
BspACI CCGC 1 cut(s) 50
BspANI GGCC 1 cut(s) 400
BspLI GGNNCC 1 cut(s) 72
BspMI ACCTGC 1 cut(s) 466
BspPI GGATC 2 cut(s) 65, 78
BsrI ACTGG 4 cut(s) 105, 218, 431, 559
BssECI CCNNGG 1 cut(s) 395
BssMI GATC 2 cut(s) 70, 562
Bst2UI CCWGG 1 cut(s) 152
Bst4CI ACNGT 2 cut(s) 80, 345
Bst6I CTCTTC 2 cut(s) 408, 566
BstAPI GCANNNNNTGC 2 cut(s) 467, 476
BstDEI CTNAG 1 cut(s) 525
BstF5I GGATG 3 cut(s) 44, 141, 310
BstHHI GCGC 1 cut(s) 334
BstKTI GATC 2 cut(s) 73, 565
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 2 cut(s) 70, 562
BstMWI GCNNNNNNNGC 3 cut(s) 314, 467, 476
BstNI CCWGG 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 150
BstSFI CTRYAG 1 cut(s) 364
BstV1I GCAGC 2 cut(s) 229, 463
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BsuI GTATCC 1 cut(s) 185
BsuRI GGCC 1 cut(s) 400
BtsCI GGATG 3 cut(s) 44, 141, 310
BtsI GCAGTG 1 cut(s) 253
BtsIMutI CAGTG 1 cut(s) 253
BveI ACCTGC 1 cut(s) 466
CaiI CAGNNNCTG 1 cut(s) 413
CfoI GCGC 1 cut(s) 334
Csp6I GTAC 4 cut(s) 229, 247, 416, 508
CviJI RGCY 5 cut(s) 5, 308, 400, 412, 491
CviKI_1 RGCY 5 cut(s) 5, 308, 400, 412, 491
CviQI GTAC 4 cut(s) 229, 247, 416, 508
DdeI CTNAG 1 cut(s) 525
DpnI GATC 2 cut(s) 72, 564
DpnII GATC 2 cut(s) 70, 562
Eam1104I CTCTTC 2 cut(s) 408, 566
EarI CTCTTC 2 cut(s) 408, 566
Eco57I CTGAAG 2 cut(s) 277, 401
EcoRII CCWGG 1 cut(s) 150
EcoT22I ATGCAT 1 cut(s) 34
FaiI YATR 8 cut(s) 245, 262, 305, 336, 518, 545, 587, 589
FauI CCCGC 1 cut(s) 57
Fnu4HI GCNGC 2 cut(s) 218, 477
FokI GGATG 3 cut(s) 31, 128, 297
Fsp4HI GCNGC 2 cut(s) 218, 477
FspBI CTAG 1 cut(s) 537
GlaI GCGC 1 cut(s) 333
GluI GCNGC 2 cut(s) 218, 477
GsuI CTGGAG 1 cut(s) 471
HaeIII GGCC 1 cut(s) 400
HhaI GCGC 1 cut(s) 334
Hin6I GCGC 1 cut(s) 332
HinP1I GCGC 1 cut(s) 332
HinfI GANTC 2 cut(s) 93, 160
HphI GGTGA 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 3 cut(s) 74, 295, 407
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 3 cut(s) 78, 450, 574
HpyCH4III ACNGT 2 cut(s) 80, 345
HpyCH4V TGCA 6 cut(s) 32, 317, 437, 461, 470, 505
HpyF10VI GCNNNNNNNGC 3 cut(s) 314, 467, 476
HpyF3I CTNAG 1 cut(s) 525
HspAI GCGC 1 cut(s) 332
Kzo9I GATC 2 cut(s) 70, 562
Lsp1109I GCAGC 2 cut(s) 229, 463
LweI GCATC 2 cut(s) 19, 41
MaeI CTAG 1 cut(s) 537
MalI GATC 2 cut(s) 72, 564
MboI GATC 2 cut(s) 70, 562
MboII GAAGA 6 cut(s) 185, 197, 269, 370, 395, 583
MflI RGATCY 1 cut(s) 70
MluCI AATT 4 cut(s) 39, 110, 326, 558
MnlI CCTC 4 cut(s) 7, 405, 411, 429
Mph1103I ATGCAT 1 cut(s) 34
MroXI GAANNNNTTC 2 cut(s) 114, 276
MspR9I CCNGG 1 cut(s) 152
MvaI CCWGG 1 cut(s) 152
MwoI GCNNNNNNNGC 3 cut(s) 314, 467, 476
NdeII GATC 2 cut(s) 70, 562
NlaIV GGNNCC 1 cut(s) 72
NmeAIII GCCGAG 1 cut(s) 376
NsiI ATGCAT 1 cut(s) 34
PaqCI CACCTGC 1 cut(s) 466
PdmI GAANNNNTTC 2 cut(s) 114, 276
PfeI GAWTC 2 cut(s) 93, 160
PflMI CCANNNNNTGG 1 cut(s) 151
PkrI GCNGC 2 cut(s) 219, 478
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
PspN4I GGNNCC 1 cut(s) 72
PsrI GAACNNNNNNTAC 2 cut(s) 221, 253
PstNI CAGNNNCTG 1 cut(s) 413
PsuI RGATCY 1 cut(s) 70
RsaI GTAC 4 cut(s) 230, 248, 417, 509
RsaNI GTAC 4 cut(s) 229, 247, 416, 508
SatI GCNGC 2 cut(s) 218, 477
Sau3AI GATC 2 cut(s) 70, 562
ScrFI CCNGG 1 cut(s) 152
SetI ASST 5 cut(s) 153, 397, 421, 442, 460
SfaNI GCATC 2 cut(s) 19, 41
SfcI CTRYAG 1 cut(s) 364
Sse9I AATT 4 cut(s) 39, 110, 326, 558
SsiI CCGC 1 cut(s) 50
SspMI CTAG 1 cut(s) 537
StyD4I CCNGG 1 cut(s) 150
TaaI ACNGT 2 cut(s) 80, 345
TasI AATT 4 cut(s) 39, 110, 326, 558
TatI WGTACW 2 cut(s) 228, 507
TfiI GAWTC 2 cut(s) 93, 160
TscAI CASTG 1 cut(s) 260
TseI GCWGC 2 cut(s) 217, 476
TspDTI ATGAA 2 cut(s) 192, 229
TspRI CASTG 1 cut(s) 260
Van91I CCANNNNNTGG 1 cut(s) 151
XapI RAATTY 2 cut(s) 39, 110
XmnI GAANNNNTTC 2 cut(s) 114, 276
XspI CTAG 1 cut(s) 537
Zsp2I ATGCAT 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.