Rw7G030640

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
43478848 .. 43479072
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G030640.1

Sequence Viewer

Length: 225 bp
ATGGCGTCTGGCACAGAGAGTGATGAAGCCTCTGACACTCCAGAAATTTACAAAGACCCAGATGATGGGAGGCAGCGATTCTTGCTTGAATTGGAGTTCATCCAATGTCTCGCAAATCCCACTTACATTCACTATTTGGCTCAAAATCGGTACTTTGAAGATGAAGCCTTCATTGGGTACTTGAAATATCTTCAGTTGGTGTACTCACGACGCTGCCAATACTGA

Protein Analysis

74

Amino Acids

8.81

Weight (kDa)

4.49

Isoelectric Point (pI)

39.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med31 PF05669 25 - 66 1.1e-16 SOH1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 65
AcsI RAATTY 1 cut(s) 45
AcuI CTGAAG 1 cut(s) 176
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 3 cut(s) 152, 179, 203
AfiI CCNNNNNNNGG 2 cut(s) 65, 174
AgsI TTSAA 3 cut(s) 89, 158, 184
AjuI GAANNNNNNNTTGG 2 cut(s) 156, 188
Alw26I GTCTC 1 cut(s) 113
ApeKI GCWGC 2 cut(s) 73, 213
ApoI RAATTY 1 cut(s) 45
BbvI GCAGC 2 cut(s) 85, 200
BccI CCATC 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 113
BisI GCNGC 2 cut(s) 74, 214
BlsI GCNGC 2 cut(s) 75, 215
BpmI CTGGAG 1 cut(s) 24
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 174
BseGI GGATG 1 cut(s) 99
BseLI CCNNNNNNNGG 2 cut(s) 65, 174
BseXI GCAGC 2 cut(s) 85, 200
BslI CCNNNNNNNGG 2 cut(s) 65, 174
BsmAI GTCTC 1 cut(s) 113
BssNI GRCGYC 1 cut(s) 5
BstACI GRCGYC 1 cut(s) 5
BstF5I GGATG 1 cut(s) 99
BstMAI GTCTC 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 82
BstV1I GCAGC 2 cut(s) 85, 200
BtsCI GGATG 1 cut(s) 99
CseI GACGC 1 cut(s) 219
Csp6I GTAC 3 cut(s) 151, 178, 202
CviJI RGCY 3 cut(s) 29, 140, 167
CviKI_1 RGCY 3 cut(s) 29, 140, 167
CviQI GTAC 3 cut(s) 151, 178, 202
Eco57I CTGAAG 1 cut(s) 176
Fnu4HI GCNGC 2 cut(s) 74, 214
FokI GGATG 1 cut(s) 86
Fsp4HI GCNGC 2 cut(s) 74, 214
GluI GCNGC 2 cut(s) 74, 214
GsuI CTGGAG 1 cut(s) 24
HgaI GACGC 1 cut(s) 219
Hin1I GRCGYC 1 cut(s) 5
HinfI GANTC 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 2 cut(s) 41, 207
Hpy8I GTNNAC 1 cut(s) 202
Hpy99I CGWCG 1 cut(s) 213
HpyAV CCTTC 1 cut(s) 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
Hsp92I GRCGYC 1 cut(s) 5
LpnPI CCDG 2 cut(s) 54, 72
Lsp1109I GCAGC 2 cut(s) 85, 200
MboII GAAGA 2 cut(s) 170, 182
MluCI AATT 2 cut(s) 45, 89
MnlI CCTC 2 cut(s) 40, 63
MwoI GCNNNNNNNGC 1 cut(s) 82
PfeI GAWTC 1 cut(s) 78
PflMI CCANNNNNTGG 1 cut(s) 65
PkrI GCNGC 2 cut(s) 75, 215
RsaI GTAC 3 cut(s) 152, 179, 203
RsaNI GTAC 3 cut(s) 151, 178, 202
SatI GCNGC 2 cut(s) 74, 214
SgeI CNNG 8 cut(s) 21, 53, 71, 94, 98, 122, 193, 219
Sse9I AATT 2 cut(s) 45, 89
TasI AATT 2 cut(s) 45, 89
TatI WGTACW 1 cut(s) 201
TfiI GAWTC 1 cut(s) 78
TseI GCWGC 2 cut(s) 73, 213
TspDTI ATGAA 4 cut(s) 39, 88, 160, 177
Van91I CCANNNNNTGG 1 cut(s) 65
XapI RAATTY 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.