Rh1BG349200

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
48201684 .. 48204704
3021 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG349200.1

Sequence Viewer

Length: 606 bp
ATGGCGTCTGGCACAGAGAGTGATGAAGCCTCTGACACTCCAGAAATTTACAAAGACCCAGATGATGGGAGGCAGCGATTCTTGCTTGAATTGGAGTTCATCCAATGTCTCGCAAATCCCACTTACATTCACTATTTGGCTCAAAATCGGTACTTTGAAGATGAAGCCTTCATTGGGTACTTGAAATATCTTCAGTATTGGCAACGTCCTGAGTACACCAAATTCATAATGTACCCTCATTGCTTGTTTTTTCTTGAGCAACTCCAAAATGCAAGCTTTCGCAATGCAATGGCACATCCTGCCAACAAGGAATTGGCGCATAGGCAGCAATTCTACTTCTGGAAGAACTATAGGCACAACCGTTTGAAACACATATTACCGAGACCTCTTCCTGAACCTGAAGCTGCACCCCCCGCCTCTGCTCCGCCTCAGCAATCTCTGCCTCCTGTTCCACCTGTGCCAGCTGCAACCATTTCTGCTGCAGCTACTGCTCCTGCCCTTCCCCCTATGCAGTATGCTAACGCCCCTGGATCTGCTCTTGCAAAGAACGATGCAAGGAATAGTGCTGTTGATCGAAGAAAGAGAAAGAGAATTGTCAAGAACTGA

Protein Analysis

201

Amino Acids

23.1

Weight (kDa)

9.0

Isoelectric Point (pI)

65.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med31 PF05669 25 - 117 9.8e-35 SOH1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 65
AciI CCGC 2 cut(s) 414, 425
AclWI GGATC 1 cut(s) 538
AcsI RAATTY 2 cut(s) 45, 221
AcuI CTGAAG 2 cut(s) 176, 420
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 4 cut(s) 152, 179, 215, 233
AfiI CCNNNNNNNGG 2 cut(s) 65, 174
AgsI TTSAA 4 cut(s) 89, 158, 184, 367
AjnI CCWGG 1 cut(s) 526
AjuI GAANNNNNNNTTGG 2 cut(s) 156, 188
AluBI AGCT 4 cut(s) 276, 404, 464, 485
AluI AGCT 4 cut(s) 276, 404, 464, 485
Alw26I GTCTC 2 cut(s) 113, 376
AlwI GGATC 1 cut(s) 538
AlwNI CAGNNNCTG 1 cut(s) 488
ApeKI GCWGC 6 cut(s) 73, 325, 404, 464, 479, 482
ApoI RAATTY 2 cut(s) 45, 221
AspLEI GCGC 1 cut(s) 319
BbvCI CCTCAGC 1 cut(s) 429
BbvI GCAGC 6 cut(s) 85, 337, 391, 451, 466, 494
BccI CCATC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 528
BcoDI GTCTC 2 cut(s) 113, 376
BfmI CTRYAG 2 cut(s) 349, 480
BisI GCNGC 6 cut(s) 74, 326, 405, 465, 480, 483
BlsI GCNGC 6 cut(s) 75, 327, 406, 466, 481, 484
Bme1390I CCNGG 1 cut(s) 528
BmrFI CCNGG 1 cut(s) 528
BmsI GCATC 1 cut(s) 541
BpmI CTGGAG 1 cut(s) 24
Bpu10I CCTNAGC 1 cut(s) 429
BpuEI CTTGAG 1 cut(s) 275
BsaHI GRCGYC 1 cut(s) 5
BsaI GGTCTC 1 cut(s) 376
BsaJI CCNNGG 1 cut(s) 526
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 174
Bse3DI GCAATG 3 cut(s) 238, 289, 294
BseBI CCWGG 1 cut(s) 528
BseDI CCNNGG 1 cut(s) 526
BseGI GGATG 2 cut(s) 99, 295
BseLI CCNNNNNNNGG 2 cut(s) 65, 174
BseMI GCAATG 3 cut(s) 238, 289, 294
BseMII CTCAG 2 cut(s) 201, 443
BseXI GCAGC 6 cut(s) 85, 337, 391, 451, 466, 494
BsgI GTGCAG 1 cut(s) 390
BslI CCNNNNNNNGG 2 cut(s) 65, 174
BsmAI GTCTC 2 cut(s) 113, 376
Bso31I GGTCTC 1 cut(s) 376
Bsp143I GATC 2 cut(s) 530, 571
BspACI CCGC 2 cut(s) 414, 425
BspCNI CTCAG 2 cut(s) 202, 442
BspMAI CTGCAG 1 cut(s) 484
BspPI GGATC 1 cut(s) 538
BspTNI GGTCTC 1 cut(s) 376
BsrDI GCAATG 3 cut(s) 238, 289, 294
BssECI CCNNGG 1 cut(s) 526
BssMI GATC 2 cut(s) 530, 571
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 528
Bst4CI ACNGT 1 cut(s) 362
Bst6I CTCTTC 1 cut(s) 393
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 3 cut(s) 299, 439, 488
BstC8I GCNNGC 2 cut(s) 274, 462
BstDEI CTNAG 2 cut(s) 210, 429
BstF5I GGATG 2 cut(s) 99, 295
BstHHI GCGC 1 cut(s) 319
BstKTI GATC 2 cut(s) 533, 574
BstMAI GTCTC 2 cut(s) 113, 376
BstMBI GATC 2 cut(s) 530, 571
BstMWI GCNNNNNNNGC 6 cut(s) 82, 299, 325, 413, 439, 488
BstNI CCWGG 1 cut(s) 528
BstSCI CCNGG 1 cut(s) 526
BstSFI CTRYAG 2 cut(s) 349, 480
BstV1I GCAGC 6 cut(s) 85, 337, 391, 451, 466, 494
BstX2I RGATCY 1 cut(s) 530
BstYI RGATCY 1 cut(s) 530
BtsCI GGATG 2 cut(s) 99, 295
Cac8I GCNNGC 2 cut(s) 274, 462
CaiI CAGNNNCTG 1 cut(s) 488
CfoI GCGC 1 cut(s) 319
Csp6I GTAC 4 cut(s) 151, 178, 214, 232
CviJI RGCY 7 cut(s) 29, 140, 167, 276, 404, 464, 485
CviKI_1 RGCY 7 cut(s) 29, 140, 167, 276, 404, 464, 485
CviQI GTAC 4 cut(s) 151, 178, 214, 232
DdeI CTNAG 2 cut(s) 210, 429
DpnI GATC 2 cut(s) 532, 573
DpnII GATC 2 cut(s) 530, 571
Eam1104I CTCTTC 1 cut(s) 393
EarI CTCTTC 1 cut(s) 393
EciI GGCGGA 1 cut(s) 414
Eco31I GGTCTC 1 cut(s) 376
Eco57I CTGAAG 2 cut(s) 176, 420
EcoRII CCWGG 1 cut(s) 526
FaiI YATR 6 cut(s) 227, 321, 351, 374, 509, 516
FauI CCCGC 1 cut(s) 421
Fnu4HI GCNGC 6 cut(s) 74, 326, 405, 465, 480, 483
FokI GGATG 2 cut(s) 86, 282
Fsp4HI GCNGC 6 cut(s) 74, 326, 405, 465, 480, 483
GlaI GCGC 1 cut(s) 318
GluI GCNGC 6 cut(s) 74, 326, 405, 465, 480, 483
GsuI CTGGAG 1 cut(s) 24
HhaI GCGC 1 cut(s) 319
Hin1I GRCGYC 1 cut(s) 5
Hin6I GCGC 1 cut(s) 317
HinP1I GCGC 1 cut(s) 317
HindIII AAGCTT 1 cut(s) 274
HinfI GANTC 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 216
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 6 cut(s) 41, 209, 254, 340, 392, 598
Hpy8I GTNNAC 1 cut(s) 216
HpyAV CCTTC 2 cut(s) 178, 509
HpyCH4III ACNGT 1 cut(s) 362
HpyCH4IV ACGT 1 cut(s) 205
HpyCH4V TGCA 8 cut(s) 272, 287, 407, 467, 482, 511, 542, 554
HpyF10VI GCNNNNNNNGC 6 cut(s) 82, 299, 325, 413, 439, 488
HpyF3I CTNAG 2 cut(s) 210, 429
HpySE526I ACGT 1 cut(s) 205
Hsp92I GRCGYC 1 cut(s) 5
HspAI GCGC 1 cut(s) 317
Kzo9I GATC 2 cut(s) 530, 571
LmnI GCTCC 2 cut(s) 427, 496
Lsp1109I GCAGC 6 cut(s) 85, 337, 391, 451, 466, 494
LweI GCATC 1 cut(s) 541
MaeII ACGT 1 cut(s) 205
MalI GATC 2 cut(s) 532, 573
MboI GATC 2 cut(s) 530, 571
MboII GAAGA 5 cut(s) 170, 182, 355, 380, 588
MflI RGATCY 1 cut(s) 530
MluCI AATT 6 cut(s) 45, 89, 221, 311, 329, 591
MnlI CCTC 7 cut(s) 40, 63, 246, 396, 427, 438, 453
MspA1I CMGCKG 1 cut(s) 464
MspR9I CCNGG 1 cut(s) 528
MvaI CCWGG 1 cut(s) 528
MwoI GCNNNNNNNGC 6 cut(s) 82, 299, 325, 413, 439, 488
NdeII GATC 2 cut(s) 530, 571
PfeI GAWTC 1 cut(s) 78
PflMI CCANNNNNTGG 1 cut(s) 65
PkrI GCNGC 6 cut(s) 75, 327, 406, 466, 481, 484
Psp6I CCWGG 1 cut(s) 526
PspGI CCWGG 1 cut(s) 526
PstI CTGCAG 1 cut(s) 484
PstNI CAGNNNCTG 1 cut(s) 488
PsuI RGATCY 1 cut(s) 530
PvuII CAGCTG 1 cut(s) 464
RsaI GTAC 4 cut(s) 152, 179, 215, 233
RsaNI GTAC 4 cut(s) 151, 178, 214, 232
SatI GCNGC 6 cut(s) 74, 326, 405, 465, 480, 483
Sau3AI GATC 2 cut(s) 530, 571
ScrFI CCNGG 1 cut(s) 528
SetI ASST 8 cut(s) 208, 278, 388, 400, 406, 457, 466, 487
SfaNI GCATC 1 cut(s) 541
SfcI CTRYAG 2 cut(s) 349, 480
SmlI CTYRAG 1 cut(s) 254
SmoI CTYRAG 1 cut(s) 254
Sse9I AATT 6 cut(s) 45, 89, 221, 311, 329, 591
SsiI CCGC 2 cut(s) 414, 425
StyD4I CCNGG 1 cut(s) 526
TaaI ACNGT 1 cut(s) 362
TaiI ACGT 1 cut(s) 208
TaqI TCGA 1 cut(s) 574
TasI AATT 6 cut(s) 45, 89, 221, 311, 329, 591
TatI WGTACW 1 cut(s) 213
TfiI GAWTC 1 cut(s) 78
TseI GCWGC 6 cut(s) 73, 325, 404, 464, 479, 482
TspDTI ATGAA 5 cut(s) 39, 88, 160, 177, 214
Van91I CCANNNNNTGG 1 cut(s) 65
XapI RAATTY 2 cut(s) 45, 221
XcmI CCANNNNNNNNNTGG 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.