Rmu_co8377585.1_g000001

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8377585.1
Physical Location & Seq
Forward (+)
1 .. 587
587 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8377585.1_g000001.1.cds

Sequence Viewer

Length: 291 bp
gaattggcgcataggcagcaattctacttctggaagaactataggcacaaccgtttgaaacacatattacctagacctcttcctgaacctgaagctgcaccccccgtctctgctccgcctcagcaacctgtgcctgctcttccacctgtgccagctgcaaccatttctgctacagctactgctcctgcccttccccctatgcagtatgctaatgcccctggatctgctcttgcaaagaatgatgcaaggaatagtgcggttgatcgaagaaagagaaagaaagaaggctaa

Protein Analysis

96

Amino Acids

10.55

Weight (kDa)

10.48

Isoelectric Point (pI)

85.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 116, 257
AclWI GGATC 1 cut(s) 229
AcuI CTGAAG 1 cut(s) 111
AgsI TTSAA 1 cut(s) 58
AjnI CCWGG 1 cut(s) 217
AluBI AGCT 3 cut(s) 95, 155, 176
AluI AGCT 3 cut(s) 95, 155, 176
Alw26I GTCTC 1 cut(s) 112
AlwI GGATC 1 cut(s) 229
AlwNI CAGNNNCTG 1 cut(s) 179
ApeKI GCWGC 3 cut(s) 16, 95, 155
AspLEI GCGC 1 cut(s) 10
BbvCI CCTCAGC 1 cut(s) 120
BbvI GCAGC 3 cut(s) 28, 82, 142
BciT130I CCWGG 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 112
BfaI CTAG 1 cut(s) 72
BfmI CTRYAG 2 cut(s) 40, 171
BisI GCNGC 3 cut(s) 17, 96, 156
BlsI GCNGC 3 cut(s) 18, 97, 157
Bme1390I CCNGG 1 cut(s) 219
BmrFI CCNGG 1 cut(s) 219
BmsI GCATC 1 cut(s) 232
Bpu10I CCTNAGC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 217
BseBI CCWGG 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 217
BseMII CTCAG 1 cut(s) 134
BseXI GCAGC 3 cut(s) 28, 82, 142
BsgI GTGCAG 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 112
BsmBI CGTCTC 1 cut(s) 112
Bsp143I GATC 2 cut(s) 221, 262
BspACI CCGC 2 cut(s) 116, 257
BspCNI CTCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 229
BspQI GCTCTTC 1 cut(s) 144
BssECI CCNNGG 1 cut(s) 217
BssMI GATC 2 cut(s) 221, 262
Bst2UI CCWGG 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 53
Bst6I CTCTTC 2 cut(s) 84, 144
BstAPI GCANNNNNTGC 1 cut(s) 130
BstC8I GCNNGC 2 cut(s) 135, 153
BstDEI CTNAG 1 cut(s) 120
BstHHI GCGC 1 cut(s) 10
BstKTI GATC 2 cut(s) 224, 265
BstMAI GTCTC 1 cut(s) 112
BstMBI GATC 2 cut(s) 221, 262
BstMWI GCNNNNNNNGC 2 cut(s) 16, 130
BstNI CCWGG 1 cut(s) 219
BstSCI CCNGG 1 cut(s) 217
BstSFI CTRYAG 2 cut(s) 40, 171
BstV1I GCAGC 3 cut(s) 28, 82, 142
BstX2I RGATCY 1 cut(s) 221
BstYI RGATCY 1 cut(s) 221
Cac8I GCNNGC 2 cut(s) 135, 153
CaiI CAGNNNCTG 1 cut(s) 179
CfoI GCGC 1 cut(s) 10
CviJI RGCY 4 cut(s) 95, 155, 176, 288
CviKI_1 RGCY 4 cut(s) 95, 155, 176, 288
DdeI CTNAG 1 cut(s) 120
DpnI GATC 2 cut(s) 223, 264
DpnII GATC 2 cut(s) 221, 262
Eam1104I CTCTTC 2 cut(s) 84, 144
EarI CTCTTC 2 cut(s) 84, 144
EciI GGCGGA 1 cut(s) 105
Eco57I CTGAAG 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 217
Esp3I CGTCTC 1 cut(s) 112
FaiI YATR 5 cut(s) 12, 42, 65, 200, 207
Fnu4HI GCNGC 3 cut(s) 17, 96, 156
Fsp4HI GCNGC 3 cut(s) 17, 96, 156
FspBI CTAG 1 cut(s) 72
GlaI GCGC 1 cut(s) 9
GluI GCNGC 3 cut(s) 17, 96, 156
HhaI GCGC 1 cut(s) 10
Hin6I GCGC 1 cut(s) 8
HinP1I GCGC 1 cut(s) 8
Hpy188III TCNNGA 2 cut(s) 31, 83
HpyAV CCTTC 2 cut(s) 200, 278
HpyCH4III ACNGT 1 cut(s) 53
HpyCH4V TGCA 5 cut(s) 98, 158, 202, 233, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 16, 130
HpyF3I CTNAG 1 cut(s) 120
HspAI GCGC 1 cut(s) 8
Kzo9I GATC 2 cut(s) 221, 262
LguI GCTCTTC 1 cut(s) 144
LmnI GCTCC 2 cut(s) 118, 187
Lsp1109I GCAGC 3 cut(s) 28, 82, 142
LweI GCATC 1 cut(s) 232
MaeI CTAG 1 cut(s) 72
MalI GATC 2 cut(s) 223, 264
MboI GATC 2 cut(s) 221, 262
MboII GAAGA 4 cut(s) 46, 71, 131, 279
MflI RGATCY 1 cut(s) 221
MluCI AATT 2 cut(s) 2, 20
MnlI CCTC 2 cut(s) 87, 129
MspA1I CMGCKG 1 cut(s) 155
MspR9I CCNGG 1 cut(s) 219
MvaI CCWGG 1 cut(s) 219
MwoI GCNNNNNNNGC 2 cut(s) 16, 130
NdeII GATC 2 cut(s) 221, 262
PciSI GCTCTTC 1 cut(s) 144
PkrI GCNGC 3 cut(s) 18, 97, 157
Psp6I CCWGG 1 cut(s) 217
PspGI CCWGG 1 cut(s) 217
PstNI CAGNNNCTG 1 cut(s) 179
PsuI RGATCY 1 cut(s) 221
PvuII CAGCTG 1 cut(s) 155
SapI GCTCTTC 1 cut(s) 144
SatI GCNGC 3 cut(s) 17, 96, 156
Sau3AI GATC 2 cut(s) 221, 262
ScrFI CCNGG 1 cut(s) 219
SetI ASST 8 cut(s) 73, 79, 91, 97, 130, 148, 157, 178
SfaNI GCATC 1 cut(s) 232
SfcI CTRYAG 2 cut(s) 40, 171
Sse9I AATT 2 cut(s) 2, 20
SsiI CCGC 2 cut(s) 116, 257
SspMI CTAG 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 217
TaaI ACNGT 1 cut(s) 53
TaqI TCGA 1 cut(s) 265
TasI AATT 2 cut(s) 2, 20
TseI GCWGC 3 cut(s) 16, 95, 155
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.