AT5G35698

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
13871715 .. 13871948
234 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G35698.1

Sequence Viewer

Length: 234 bp
ATGGAGAACAAAAGAATGGGTGTATTTGTGGTGGTGATGTTGATGATTGGAACCCTAATGGTTGAATCAAGGGAAATAGCAACTACTCCAATCACTGTAAAACCAACTTTTCCTATTTGCTATACTACATGCTTTGCACTGTGCCTTCTTAATCCAATCTTTCTAAACAAAAAAAAATGTCCTGAAAAATGTGGCAATAAATGTCTAGAATCAAAACCAAATCCACCAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.65

Weight (kDa)

9.19

Isoelectric Point (pI)

43.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 46
BfaI CTAG 1 cut(s) 206
BmiI GGNNCC 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 52
Bst4CI ACNGT 2 cut(s) 97, 141
BstNSI RCATGY 1 cut(s) 132
BtsIMutI CAGTG 2 cut(s) 93, 137
CviAII CATG 1 cut(s) 129
FaeI CATG 1 cut(s) 132
FaiI YATR 2 cut(s) 123, 130
FatI CATG 1 cut(s) 128
FspBI CTAG 1 cut(s) 206
Hin1II CATG 1 cut(s) 132
HinfI GANTC 2 cut(s) 65, 209
HphI GGTGA 1 cut(s) 46
Hpy188III TCNNGA 2 cut(s) 182, 206
HpyAV CCTTC 1 cut(s) 155
HpyCH4III ACNGT 2 cut(s) 97, 141
HpyCH4V TGCA 1 cut(s) 137
Hsp92II CATG 1 cut(s) 132
LpnPI CCDG 1 cut(s) 195
MaeI CTAG 1 cut(s) 206
MseI TTAA 1 cut(s) 150
MslI CAYNNNNRTG 1 cut(s) 229
NlaIII CATG 1 cut(s) 132
NlaIV GGNNCC 1 cut(s) 52
NspI RCATGY 1 cut(s) 132
PfeI GAWTC 2 cut(s) 65, 209
PspN4I GGNNCC 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 229
SaqAI TTAA 1 cut(s) 150
SgeI CNNG 4 cut(s) 81, 141, 194, 218
SmiMI CAYNNNNRTG 1 cut(s) 229
SspMI CTAG 1 cut(s) 206
TaaI ACNGT 2 cut(s) 97, 141
TfiI GAWTC 2 cut(s) 65, 209
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TscAI CASTG 2 cut(s) 100, 144
TspRI CASTG 2 cut(s) 100, 144
XbaI TCTAGA 1 cut(s) 205
XceI RCATGY 1 cut(s) 132
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.