Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

OG0004296

Physical Location & Seq

Genomic Coordinates Forward (+)

5327892 .. 5328335

Gene Structure 444 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G073800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

ATGGAGGCAAAGAGAGTTAGGGCTATAGTGATAGTTTCCTTGGTGCTTGGATTGCTCATAGGACAATCCACAGCTTCTAACTTCAAAGACTGCTATGAAGTATGCTTTGCTACATGTTTCCCTGAGAAAAAAGACCCCATCTATTGTGGTGGCCATTGCTTGAGAAAATGCATTTTCCATCCTTCTTCTTTGGACACCCAAACATACCCCAAACACTTCTGCAAGCTTGGGTGTGCTACTTCTTTATGCAACAATATCAGCACCAAAGATAATCATAATGGAGGAAAAGTAGAGACTTGTGTGGATTCTTGCTCAAGGACTTGCACTGCTACTTACAAGGCAGGAAAGCATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006950 GO:0006952 GO:0008150 GO:0050896

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

118

Amino Acids

12.83

Weight (kDa)

8.74

Isoelectric Point (pI)

30.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004296)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35698
fragaria_vesca	FvH4_6g30990
malus_domestica	MD09G1214500.v1.1 MD09G1214600.v1.1 MD17G1196900.v1.1
prunus_persica	Prupe.3G072600_v2.0.a1 Prupe.3G072700_v2.0.a1 Prupe.3G072800_v2.0.a1 Prupe.3G072900_v2.0.a1 Prupe.3G073000_v2.0.a1 Prupe.3G073100_v2.0.a1 Prupe.3G073200_v2.0.a1 Prupe.3G073800_v2.0.a1 Prupe.6G180200_v2.0.a1
pyrus_communis	pycom09g13140 pycom17g20200
rosa_chinensis	RchiOBHm_Chr7g0236281
rosa_laevigata	RLG00000001091 RLG00000019664
rosa_multiflora	Rmu_sc0000765.1_g000025
rosa_roxburghii	Rroxscaffold_2G00106990 Rroxscaffold_3G00225280
rosa_rugosa	Rorug02G0345300
rosa_samantha	Rh2AG391300 Rh2BG398800 Rh2CG378300 Rh2DG413900 Rh7AG450100 Rh7CG470000 Rh7DG439400
rosa_wichuraiana	Rw2G032050 Rw7G037420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	151
AflIII	ACRYGT	1 cut(s)	113
AgsI	TTSAA	1 cut(s)	85
AluBI	AGCT	2 cut(s)	74, 226
AluI	AGCT	2 cut(s)	74, 226
Alw26I	GTCTC	1 cut(s)	287
AoxI	GGCC	1 cut(s)	151
BalI	TGGCCA	1 cut(s)	153
BccI	CCATC	2 cut(s)	146, 186
BcoDI	GTCTC	1 cut(s)	287
BfmI	CTRYAG	1 cut(s)	24
BpuEI	CTTGAG	2 cut(s)	181, 298
BsaJI	CCNNGG	1 cut(s)	39
BsaXI	ACNNNNNCTCC	2 cut(s)	273, 303
Bse3DI	GCAATG	1 cut(s)	154
BseDI	CCNNGG	1 cut(s)	39
BseGI	GGATG	1 cut(s)	178
BseMI	GCAATG	1 cut(s)	154
BseMII	CTCAG	1 cut(s)	114
BshFI	GGCC	1 cut(s)	153
BsmAI	GTCTC	1 cut(s)	287
BsnI	GGCC	1 cut(s)	153
BspANI	GGCC	1 cut(s)	153
BspCNI	CTCAG	1 cut(s)	115
BsrDI	GCAATG	1 cut(s)	154
BssECI	CCNNGG	1 cut(s)	39
BssT1I	CCWWGG	1 cut(s)	39
BstC8I	GCNNGC	1 cut(s)	224
BstDEI	CTNAG	1 cut(s)	123
BstF5I	GGATG	1 cut(s)	178
BstMAI	GTCTC	1 cut(s)	287
BstMWI	GCNNNNNNNGC	1 cut(s)	52
BstNSI	RCATGY	1 cut(s)	117
BstSFI	CTRYAG	1 cut(s)	24
BsuRI	GGCC	1 cut(s)	153
BtsCI	GGATG	1 cut(s)	178
BtsI	GCAGTG	1 cut(s)	324
BtsIMutI	CAGTG	1 cut(s)	324
Cac8I	GCNNGC	1 cut(s)	224
CviAII	CATG	1 cut(s)	114
CviJI	RGCY	4 cut(s)	23, 74, 153, 226
CviKI_1	RGCY	4 cut(s)	23, 74, 153, 226
DdeI	CTNAG	1 cut(s)	123
EaeI	YGGCCR	1 cut(s)	151
Eco130I	CCWWGG	1 cut(s)	39
EcoT14I	CCWWGG	1 cut(s)	39
EcoT22I	ATGCAT	1 cut(s)	173
ErhI	CCWWGG	1 cut(s)	39
FaeI	CATG	1 cut(s)	117
FaiI	YATR	8 cut(s)	26, 59, 96, 103, 115, 205, 247, 276
FatI	CATG	1 cut(s)	113
FokI	GGATG	1 cut(s)	165
HaeIII	GGCC	1 cut(s)	153
Hin1II	CATG	1 cut(s)	117
HindIII	AAGCTT	1 cut(s)	224
HinfI	GANTC	1 cut(s)	305
HpyAV	CCTTC	1 cut(s)	192
HpyCH4V	TGCA	4 cut(s)	171, 222, 249, 324
HpyF10VI	GCNNNNNNNGC	1 cut(s)	52
HpyF3I	CTNAG	1 cut(s)	123
Hsp92II	CATG	1 cut(s)	117
LpnPI	CCDG	2 cut(s)	135, 327
MboII	GAAGA	1 cut(s)	177
MlsI	TGGCCA	1 cut(s)	153
MluNI	TGGCCA	1 cut(s)	153
MnlI	CCTC	1 cut(s)	275
Mox20I	TGGCCA	1 cut(s)	153
Mph1103I	ATGCAT	1 cut(s)	173
MscI	TGGCCA	1 cut(s)	153
MseI	TTAA	1 cut(s)	352
Msp20I	TGGCCA	1 cut(s)	153
MwoI	GCNNNNNNNGC	1 cut(s)	52
NlaIII	CATG	1 cut(s)	117
NsiI	ATGCAT	1 cut(s)	173
NspI	RCATGY	1 cut(s)	117
PciI	ACATGT	1 cut(s)	113
PfeI	GAWTC	1 cut(s)	305
PscI	ACATGT	1 cut(s)	113
SaqAI	TTAA	1 cut(s)	352
SetI	ASST	2 cut(s)	76, 228
SfcI	CTRYAG	1 cut(s)	24
SmlI	CTYRAG	2 cut(s)	160, 313
SmoI	CTYRAG	2 cut(s)	160, 313
StyI	CCWWGG	1 cut(s)	39
TfiI	GAWTC	1 cut(s)	305
Tru1I	TTAA	1 cut(s)	352
Tru9I	TTAA	1 cut(s)	352
TscAI	CASTG	1 cut(s)	331
TspDTI	ATGAA	1 cut(s)	111
TspRI	CASTG	1 cut(s)	331
XceI	RCATGY	1 cut(s)	117
Zsp2I	ATGCAT	1 cut(s)	173

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.