FvH4_6g30990

Thionin-like protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
24184439 .. 24185306
868 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g30990.t1

Sequence Viewer

Length: 357 bp
ATGGCAATGGAGGGAAGAAAACTAAGTTCTGTATTGCTGGTTTGTGTTTTACTTGGTTTACTCATAGGACAGTCCACAGCTTTATCCTTCGAGTTGTGCTATGGTGCTTGCTTCATCAAATGTATGATCGAACCCCCACACAATCCCTTCAAATGTGCCTTGCCTTGCTTGAACAAATGCATCTTACCAACTGATGATCAGCAAACAAACCCTATATACTTCTGCACGCTTGGTTGTGCTACCTCTTCCTGTGCCAATATCAGCACCAATCTCAGTCCAAATGAAGGAGAAGTGAAGACTTGTGTGGATTCTTGCTCTGGGAACTGCACCAATACATACTCGCCAATGAAGAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

12.66

Weight (kDa)

5.66

Isoelectric Point (pI)

54.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 284
AgsI TTSAA 2 cut(s) 151, 172
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
BbsI GAAGAC 1 cut(s) 302
BclI TGATCA 1 cut(s) 196
BmsI GCATC 1 cut(s) 189
BpiI GAAGAC 1 cut(s) 302
Bsc4I CCNNNNNNNGG 1 cut(s) 284
Bse3DI GCAATG 1 cut(s) 12
BseLI CCNNNNNNNGG 1 cut(s) 284
BseMI GCAATG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 286
BsgI GTGCAG 2 cut(s) 208, 310
BslI CCNNNNNNNGG 1 cut(s) 284
Bsp143I GATC 2 cut(s) 126, 196
BspCNI CTCAG 1 cut(s) 285
BsrDI GCAATG 1 cut(s) 12
BssMI GATC 2 cut(s) 126, 196
Bst4CI ACNGT 1 cut(s) 72
Bst6I CTCTTC 1 cut(s) 250
BstC8I GCNNGC 2 cut(s) 109, 227
BstDEI CTNAG 2 cut(s) 23, 272
BstKTI GATC 2 cut(s) 129, 199
BstMBI GATC 2 cut(s) 126, 196
BstV2I GAAGAC 1 cut(s) 302
Cac8I GCNNGC 2 cut(s) 109, 227
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
DdeI CTNAG 2 cut(s) 23, 272
DpnI GATC 2 cut(s) 128, 198
DpnII GATC 2 cut(s) 126, 196
Eam1104I CTCTTC 1 cut(s) 250
EarI CTCTTC 1 cut(s) 250
EcoT22I ATGCAT 1 cut(s) 182
FaiI YATR 6 cut(s) 65, 102, 125, 215, 217, 337
FbaI TGATCA 1 cut(s) 196
HinfI GANTC 1 cut(s) 308
Hpy166II GTNNAC 2 cut(s) 59, 75
Hpy8I GTNNAC 2 cut(s) 59, 75
HpyAV CCTTC 3 cut(s) 97, 157, 278
HpyCH4III ACNGT 1 cut(s) 72
HpyCH4V TGCA 3 cut(s) 180, 225, 327
HpyF3I CTNAG 2 cut(s) 23, 272
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 2 cut(s) 126, 196
LpnPI CCDG 3 cut(s) 23, 262, 303
LweI GCATC 1 cut(s) 189
MalI GATC 2 cut(s) 128, 198
MboI GATC 2 cut(s) 126, 196
MboII GAAGA 3 cut(s) 27, 237, 307
MnlI CCTC 2 cut(s) 4, 253
Mph1103I ATGCAT 1 cut(s) 182
NdeII GATC 2 cut(s) 126, 196
NsiI ATGCAT 1 cut(s) 182
PfeI GAWTC 1 cut(s) 308
Sau3AI GATC 2 cut(s) 126, 196
SetI ASST 2 cut(s) 82, 245
SfaNI GCATC 1 cut(s) 189
TaaI ACNGT 1 cut(s) 72
TaqI TCGA 2 cut(s) 90, 129
TfiI GAWTC 1 cut(s) 308
TspDTI ATGAA 2 cut(s) 103, 297
Zsp2I ATGCAT 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.