FvH4_1g08340

acyl-CoA-binding protein-like

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
4411888 .. 4412712
825 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g08340.t1

Sequence Viewer

Length: 312 bp
ATGGCTCAGGCTCTTCAGGAGGAATTTAAAGAGTATGCAGAGAAGGCCAAGTCTTTGCCCTCAACAACAAAGGATGCAGATAAACTAGTACTCTACGGCCTCTACAAGCAAGCAACCGTTGGCTCCGTCAGTACTAATCGACCAGGGTTCTTTAGTCCAACTGAGAGGGCCAAATGGGATGCTTGGAAAGCAGTTGAAGGGAAGAGCCAAGAAGAAGCAATTGCTGAATACATTGAAAAGGTGAAGCAGCTGCTAGCAGCTTCTACAAATACGTACAAGAATGATTGTTCAGCATCGGTCTCTTTCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.43

Weight (kDa)

6.29

Isoelectric Point (pI)

37.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ACBP PF00887 6 - 81 2.2e-26 Acyl CoA binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 23
AfaI GTAC 3 cut(s) 90, 133, 275
AgsI TTSAA 3 cut(s) 197, 236, 307
AhlI ACTAGT 1 cut(s) 85
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 2 cut(s) 250, 260
AluI AGCT 2 cut(s) 250, 260
Alw26I GTCTC 1 cut(s) 304
AoxI GGCC 3 cut(s) 45, 97, 168
ApeKI GCWGC 3 cut(s) 247, 250, 257
ApoI RAATTY 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 168
AsuHPI GGTGA 1 cut(s) 253
AsuNHI GCTAGC 1 cut(s) 253
BbvI GCAGC 3 cut(s) 237, 259, 269
BceAI ACGGC 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 144
BcoDI GTCTC 1 cut(s) 304
BcuI ACTAGT 1 cut(s) 85
BfaI CTAG 2 cut(s) 86, 254
BisI GCNGC 3 cut(s) 248, 251, 258
BlsI GCNGC 3 cut(s) 249, 252, 259
BmcAI AGTACT 2 cut(s) 90, 133
Bme1390I CCNGG 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 168
BmiI GGNNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 144
BmsI GCATC 3 cut(s) 64, 169, 302
BmtI GCTAGC 1 cut(s) 257
Bpu10I CCTNAGC 1 cut(s) 6
BsaAI YACGTR 1 cut(s) 273
BsaI GGTCTC 1 cut(s) 304
BsaJI CCNNGG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 143
BseGI GGATG 2 cut(s) 79, 184
BseMII CTCAG 2 cut(s) 20, 153
BseXI GCAGC 3 cut(s) 237, 259, 269
BshFI GGCC 3 cut(s) 47, 99, 170
BsmAI GTCTC 1 cut(s) 304
BsnI GGCC 3 cut(s) 47, 99, 170
Bso31I GGTCTC 1 cut(s) 304
BspANI GGCC 3 cut(s) 47, 99, 170
BspCNI CTCAG 2 cut(s) 19, 154
BspLI GGNNCC 1 cut(s) 124
BspOI GCTAGC 1 cut(s) 257
BspQI GCTCTTC 2 cut(s) 18, 197
BspTNI GGTCTC 1 cut(s) 304
BssECI CCNNGG 1 cut(s) 143
Bst2UI CCWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 118
Bst6I CTCTTC 2 cut(s) 18, 197
BstBAI YACGTR 1 cut(s) 273
BstC8I GCNNGC 2 cut(s) 111, 255
BstDEI CTNAG 2 cut(s) 6, 162
BstF5I GGATG 2 cut(s) 79, 184
BstMAI GTCTC 1 cut(s) 304
BstMWI GCNNNNNNNGC 2 cut(s) 44, 188
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstSNI TACGTA 1 cut(s) 273
BstV1I GCAGC 3 cut(s) 237, 259, 269
BsuRI GGCC 3 cut(s) 47, 99, 170
BtsCI GGATG 2 cut(s) 79, 184
Cac8I GCNNGC 2 cut(s) 111, 255
Cfr13I GGNCC 1 cut(s) 168
Csp6I GTAC 3 cut(s) 89, 132, 274
CviJI RGCY 9 cut(s) 5, 11, 47, 99, 123, 170, 207, 250, 260
CviKI_1 RGCY 9 cut(s) 5, 11, 47, 99, 123, 170, 207, 250, 260
CviQI GTAC 3 cut(s) 89, 132, 274
DdeI CTNAG 2 cut(s) 6, 162
DraI TTTAAA 1 cut(s) 28
Eam1104I CTCTTC 2 cut(s) 18, 197
EarI CTCTTC 2 cut(s) 18, 197
Eco105I TACGTA 1 cut(s) 273
Eco31I GGTCTC 1 cut(s) 304
EcoRII CCWGG 1 cut(s) 142
FaiI YATR 1 cut(s) 36
Fnu4HI GCNGC 3 cut(s) 248, 251, 258
FokI GGATG 2 cut(s) 86, 191
Fsp4HI GCNGC 3 cut(s) 248, 251, 258
FspBI CTAG 2 cut(s) 86, 254
GluI GCNGC 3 cut(s) 248, 251, 258
HaeIII GGCC 3 cut(s) 47, 99, 170
HphI GGTGA 1 cut(s) 253
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 37, 191
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4IV ACGT 1 cut(s) 272
HpyCH4V TGCA 2 cut(s) 38, 77
HpyF10VI GCNNNNNNNGC 2 cut(s) 44, 188
HpyF3I CTNAG 2 cut(s) 6, 162
HpySE526I ACGT 1 cut(s) 272
LguI GCTCTTC 2 cut(s) 18, 197
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 3 cut(s) 2, 129, 156
Lsp1109I GCAGC 3 cut(s) 237, 259, 269
LweI GCATC 3 cut(s) 64, 169, 302
MaeI CTAG 2 cut(s) 86, 254
MaeII ACGT 1 cut(s) 272
MboII GAAGA 3 cut(s) 5, 214, 224
MfeI CAATTG 1 cut(s) 219
MluCI AATT 3 cut(s) 23, 219, 307
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 4 cut(s) 13, 70, 110, 159
MseI TTAA 2 cut(s) 27, 310
MspA1I CMGCKG 1 cut(s) 250
MspR9I CCNGG 1 cut(s) 144
MunI CAATTG 1 cut(s) 219
MvaI CCWGG 1 cut(s) 144
MwoI GCNNNNNNNGC 2 cut(s) 44, 188
NheI GCTAGC 1 cut(s) 253
NlaIV GGNNCC 1 cut(s) 124
PciSI GCTCTTC 2 cut(s) 18, 197
PkrI GCNGC 3 cut(s) 249, 252, 259
Ppu21I YACGTR 1 cut(s) 273
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspN4I GGNNCC 1 cut(s) 124
PspPI GGNCC 1 cut(s) 168
PvuII CAGCTG 1 cut(s) 250
RsaI GTAC 3 cut(s) 90, 133, 275
RsaNI GTAC 3 cut(s) 89, 132, 274
SapI GCTCTTC 2 cut(s) 18, 197
SaqAI TTAA 2 cut(s) 27, 310
SatI GCNGC 3 cut(s) 248, 251, 258
Sau96I GGNCC 1 cut(s) 168
ScaI AGTACT 2 cut(s) 90, 133
ScrFI CCNGG 1 cut(s) 144
SetI ASST 4 cut(s) 243, 252, 262, 275
SfaNI GCATC 3 cut(s) 64, 169, 302
SnaBI TACGTA 1 cut(s) 273
SpeI ACTAGT 1 cut(s) 85
Sse9I AATT 3 cut(s) 23, 219, 307
SspMI CTAG 2 cut(s) 86, 254
StyD4I CCNGG 1 cut(s) 142
TaaI ACNGT 1 cut(s) 118
TaiI ACGT 1 cut(s) 275
TaqI TCGA 1 cut(s) 139
TaqII GACCGA 1 cut(s) 286
TasI AATT 3 cut(s) 23, 219, 307
TatI WGTACW 2 cut(s) 88, 131
Tru1I TTAA 2 cut(s) 27, 310
Tru9I TTAA 2 cut(s) 27, 310
TseI GCWGC 3 cut(s) 247, 250, 257
TspGWI ACGGA 1 cut(s) 115
XapI RAATTY 1 cut(s) 23
XspI CTAG 2 cut(s) 86, 254
ZrmI AGTACT 2 cut(s) 90, 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.