MD02G1087600.v1.1

acyl-CoA-binding protein-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
6858437 .. 6859051
615 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1087600.v1.1.491

Sequence Viewer

Length: 195 bp
ATGCATGCAGCAATTTTCATGTTAACTATATATATATGTATATATTATACAGATCGACCTGGATTTTTCAGCCCAACAGAGAGGGCCAAATGGGATGCATGGAAAGCTGTTGATGGGAAGAGCAAAGAAGAAGCAATGACTGAATACATTGTAAAGGTGAAGCAGCTGCAACTACAAGAAGTAGCCTCCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.45

Weight (kDa)

6.54

Isoelectric Point (pI)

48.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ACBP PF00887 17 - 53 3e-12 Acyl CoA binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 58
AluBI AGCT 2 cut(s) 107, 166
AluI AGCT 2 cut(s) 107, 166
AoxI GGCC 1 cut(s) 84
ApeKI GCWGC 3 cut(s) 8, 163, 166
AspS9I GGNCC 1 cut(s) 84
AsuHPI GGTGA 1 cut(s) 169
BbvI GCAGC 3 cut(s) 20, 153, 175
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 60
BisI GCNGC 3 cut(s) 9, 164, 167
BlsI GCNGC 3 cut(s) 10, 165, 168
Bme1390I CCNGG 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 60
BmsI GCATC 1 cut(s) 85
Bse3DI GCAATG 1 cut(s) 141
BseBI CCWGG 1 cut(s) 60
BseGI GGATG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 141
BseXI GCAGC 3 cut(s) 20, 153, 175
BshFI GGCC 1 cut(s) 86
BsnI GGCC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 52
BspANI GGCC 1 cut(s) 86
BspQI GCTCTTC 1 cut(s) 113
BsrDI GCAATG 1 cut(s) 141
BssMI GATC 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 113
BstC8I GCNNGC 1 cut(s) 6
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstNI CCWGG 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 58
BstV1I GCAGC 3 cut(s) 20, 153, 175
BsuRI GGCC 1 cut(s) 86
BtsCI GGATG 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 84
CviAII CATG 3 cut(s) 5, 19, 99
CviJI RGCY 5 cut(s) 72, 86, 107, 166, 185
CviKI_1 RGCY 5 cut(s) 72, 86, 107, 166, 185
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 58
EcoT22I ATGCAT 2 cut(s) 6, 100
FaeI CATG 3 cut(s) 8, 22, 102
FatI CATG 3 cut(s) 4, 18, 98
Fnu4HI GCNGC 3 cut(s) 9, 164, 167
FokI GGATG 1 cut(s) 107
Fsp4HI GCNGC 3 cut(s) 9, 164, 167
GluI GCNGC 3 cut(s) 9, 164, 167
HaeIII GGCC 1 cut(s) 86
Hin1II CATG 3 cut(s) 8, 22, 102
HincII GTYRAC 1 cut(s) 24
HindII GTYRAC 1 cut(s) 24
HpaI GTTAAC 1 cut(s) 24
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 1 cut(s) 24
Hpy8I GTNNAC 1 cut(s) 24
HpyCH4V TGCA 4 cut(s) 4, 8, 98, 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
Hsp92II CATG 3 cut(s) 8, 22, 102
KspAI GTTAAC 1 cut(s) 24
Kzo9I GATC 1 cut(s) 52
LguI GCTCTTC 1 cut(s) 113
LpnPI CCDG 2 cut(s) 45, 72
Lsp1109I GCAGC 3 cut(s) 20, 153, 175
LweI GCATC 1 cut(s) 85
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 2 cut(s) 130, 140
MluCI AATT 1 cut(s) 12
MnlI CCTC 1 cut(s) 75
Mph1103I ATGCAT 2 cut(s) 6, 100
MseI TTAA 1 cut(s) 23
MspA1I CMGCKG 1 cut(s) 166
MspR9I CCNGG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 60
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 1 cut(s) 52
NlaIII CATG 3 cut(s) 8, 22, 102
NsiI ATGCAT 2 cut(s) 6, 100
NspI RCATGY 1 cut(s) 8
PaeI GCATGC 1 cut(s) 8
PciSI GCTCTTC 1 cut(s) 113
PkrI GCNGC 3 cut(s) 10, 165, 168
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
PspPI GGNCC 1 cut(s) 84
PvuII CAGCTG 1 cut(s) 166
SapI GCTCTTC 1 cut(s) 113
SaqAI TTAA 1 cut(s) 23
SatI GCNGC 3 cut(s) 9, 164, 167
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 84
ScrFI CCNGG 1 cut(s) 60
SetI ASST 5 cut(s) 61, 109, 159, 168, 194
SfaNI GCATC 1 cut(s) 85
SgeI CNNG 6 cut(s) 17, 31, 71, 72, 111, 188
SphI GCATGC 1 cut(s) 8
Sse9I AATT 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 58
TaqI TCGA 1 cut(s) 55
TasI AATT 1 cut(s) 12
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TseI GCWGC 3 cut(s) 8, 163, 166
TspDTI ATGAA 1 cut(s) 7
XceI RCATGY 1 cut(s) 8
Zsp2I ATGCAT 2 cut(s) 6, 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.