FvH4_3g38891

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0007230
Physical Location & Seq
Reverse (-)
33170437 .. 33170992
556 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g38891.t1

Sequence Viewer

Length: 468 bp
ATGATGATGGGATTTGGAGGAAGTCGACTGTCCTTGTTTCTCTTGCTTGTCTTTGTCTCAAGCTCTTCTGCCAGGAAGTTGATTACATTTCCAGATCATGAGATGGTAGTGATCCAGAGCACGGAAGACATGTCCATGGTACTAGACGACTATCCTGCCCCAGGTGCTAGTCATCGGCATGATCCCCCTCACCATAATGGCGAATTCGGAAAAGTCGACGGTGACAACGATAATGGCGATTCCGTCATGTCCATGGTATTAGATGACTATCCTGCCTCAAGTGCTAGTCATCGACATGATCCCCCTTCTCATCCTCCTCCGCATAATAACGAATCTGACATACTGTCTATCGTACTAGACGACTATCCTGGGCCAAGTGCTAATCCTCGACATGATCCTCCTCCTCATCCCCCCACTTATAATGGCAAAACCGGCAAAGTTACCGGTGACGACGACGATGGTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

16.74

Weight (kDa)

4.76

Isoelectric Point (pI)

44.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 420
AccI GTMKAC 2 cut(s) 25, 216
AciI CCGC 1 cut(s) 320
AclWI GGATC 4 cut(s) 106, 176, 293, 389
AcsI RAATTY 1 cut(s) 203
AfaI GTAC 2 cut(s) 141, 354
AfiI CCNNNNNNNGG 2 cut(s) 121, 161
AflIII ACRYGT 1 cut(s) 129
AgeI ACCGGT 1 cut(s) 443
AhdI GACNNNNNGTC 1 cut(s) 343
AjnI CCWGG 3 cut(s) 71, 160, 367
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
Alw21I GWGCWC 1 cut(s) 122
Alw26I GTCTC 1 cut(s) 61
AlwI GGATC 4 cut(s) 106, 176, 293, 389
AoxI GGCC 1 cut(s) 371
ApoI RAATTY 1 cut(s) 203
AsiGI ACCGGT 1 cut(s) 443
AspS9I GGNCC 1 cut(s) 371
AsuHPI GGTGA 3 cut(s) 182, 233, 458
BbsI GAAGAC 1 cut(s) 132
Bbv12I GWGCWC 1 cut(s) 122
BccI CCATC 2 cut(s) 97, 452
BcgI CGANNNNNNTGC 3 cut(s) 137, 171, 443
BciT130I CCWGG 3 cut(s) 73, 162, 369
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 4 cut(s) 143, 168, 285, 356
Bme1390I CCNGG 3 cut(s) 73, 162, 369
BmeRI GACNNNNNGTC 1 cut(s) 343
BmgT120I GGNCC 1 cut(s) 371
BmrFI CCNGG 3 cut(s) 73, 162, 369
BpiI GAAGAC 1 cut(s) 132
BpuEI CTTGAG 2 cut(s) 43, 262
BsaBI GATNNNNATC 1 cut(s) 267
BsaJI CCNNGG 4 cut(s) 135, 160, 252, 368
BsaWI WCCGGW 1 cut(s) 443
Bsc4I CCNNNNNNNGG 2 cut(s) 121, 161
Bse118I RCCGGY 2 cut(s) 431, 443
Bse8I GATNNNNATC 1 cut(s) 267
BseBI CCWGG 3 cut(s) 73, 162, 369
BseDI CCNNGG 4 cut(s) 135, 160, 252, 368
BseGI GGATG 2 cut(s) 310, 406
BseJI GATNNNNATC 1 cut(s) 267
BseLI CCNNNNNNNGG 2 cut(s) 121, 161
BseRI GAGGAG 3 cut(s) 306, 390, 393
BshFI GGCC 1 cut(s) 373
BshTI ACCGGT 1 cut(s) 443
BsiHKAI GWGCWC 1 cut(s) 122
BsiSI CCGG 2 cut(s) 432, 444
BslI CCNNNNNNNGG 2 cut(s) 121, 161
BsmAI GTCTC 1 cut(s) 61
BsnI GGCC 1 cut(s) 373
Bsp1286I GDGCHC 1 cut(s) 122
Bsp143I GATC 5 cut(s) 94, 111, 181, 298, 394
Bsp19I CCATGG 2 cut(s) 135, 252
BspACI CCGC 1 cut(s) 320
BspANI GGCC 1 cut(s) 373
BspHI TCATGA 1 cut(s) 97
BspPI GGATC 4 cut(s) 106, 176, 293, 389
BspQI GCTCTTC 1 cut(s) 70
BsrFI RCCGGY 2 cut(s) 431, 443
BssAI RCCGGY 2 cut(s) 431, 443
BssECI CCNNGG 4 cut(s) 135, 160, 252, 368
BssMI GATC 5 cut(s) 94, 111, 181, 298, 394
BssT1I CCWWGG 2 cut(s) 135, 252
Bst2UI CCWGG 3 cut(s) 73, 162, 369
Bst4CI ACNGT 3 cut(s) 30, 221, 345
Bst6I CTCTTC 1 cut(s) 70
BstDSI CCRYGG 2 cut(s) 135, 252
BstENI CCTNNNNNAGG 1 cut(s) 159
BstF5I GGATG 2 cut(s) 310, 406
BstKTI GATC 5 cut(s) 97, 114, 184, 301, 397
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 5 cut(s) 94, 111, 181, 298, 394
BstMWI GCNNNNNNNGC 3 cut(s) 164, 281, 432
BstNI CCWGG 3 cut(s) 73, 162, 369
BstNSI RCATGY 1 cut(s) 133
BstSCI CCNGG 3 cut(s) 71, 160, 367
BstV2I GAAGAC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 373
BtgI CCRYGG 2 cut(s) 135, 252
BtsCI GGATG 2 cut(s) 310, 406
CciI TCATGA 1 cut(s) 97
Cfr10I RCCGGY 2 cut(s) 431, 443
Cfr13I GGNCC 1 cut(s) 371
Csp6I GTAC 2 cut(s) 140, 353
CspAI ACCGGT 1 cut(s) 443
CviAII CATG 9 cut(s) 98, 130, 136, 179, 247, 253, 296, 392, 465
CviJI RGCY 2 cut(s) 63, 373
CviKI_1 RGCY 2 cut(s) 63, 373
CviQI GTAC 2 cut(s) 140, 353
DpnI GATC 5 cut(s) 96, 113, 183, 300, 396
DpnII GATC 5 cut(s) 94, 111, 181, 298, 394
DriI GACNNNNNGTC 1 cut(s) 343
Eam1104I CTCTTC 1 cut(s) 70
Eam1105I GACNNNNNGTC 1 cut(s) 343
EarI CTCTTC 1 cut(s) 70
Eco130I CCWWGG 2 cut(s) 135, 252
EcoNI CCTNNNNNAGG 1 cut(s) 159
EcoRI GAATTC 1 cut(s) 203
EcoRII CCWGG 3 cut(s) 71, 160, 367
EcoT14I CCWWGG 2 cut(s) 135, 252
ErhI CCWWGG 2 cut(s) 135, 252
FaeI CATG 9 cut(s) 101, 133, 139, 182, 250, 256, 299, 395, 468
FatI CATG 9 cut(s) 97, 129, 135, 178, 246, 252, 295, 391, 464
FblI GTMKAC 2 cut(s) 25, 216
FokI GGATG 2 cut(s) 297, 393
FspBI CTAG 4 cut(s) 143, 168, 285, 356
HaeIII GGCC 1 cut(s) 373
HapII CCGG 2 cut(s) 432, 444
Hin1II CATG 9 cut(s) 101, 133, 139, 182, 250, 256, 299, 395, 468
HincII GTYRAC 2 cut(s) 26, 217
HindII GTYRAC 2 cut(s) 26, 217
HinfI GANTC 2 cut(s) 239, 332
HpaII CCGG 2 cut(s) 432, 444
HphI GGTGA 3 cut(s) 182, 233, 458
Hpy166II GTNNAC 2 cut(s) 26, 217
Hpy188I TCNGA 2 cut(s) 209, 337
Hpy188III TCNNGA 3 cut(s) 92, 98, 115
Hpy8I GTNNAC 2 cut(s) 26, 217
Hpy99I CGWCG 3 cut(s) 221, 455, 458
HpyAV CCTTC 1 cut(s) 315
HpyCH4III ACNGT 3 cut(s) 30, 221, 345
HpyCH4V TGCA 1 cut(s) 464
HpyF10VI GCNNNNNNNGC 3 cut(s) 164, 281, 432
Hsp92II CATG 9 cut(s) 101, 133, 139, 182, 250, 256, 299, 395, 468
Kzo9I GATC 5 cut(s) 94, 111, 181, 298, 394
LguI GCTCTTC 1 cut(s) 70
MaeI CTAG 4 cut(s) 143, 168, 285, 356
MaeIII GTNAC 3 cut(s) 221, 439, 446
MalI GATC 5 cut(s) 96, 113, 183, 300, 396
MboI GATC 5 cut(s) 94, 111, 181, 298, 394
MboII GAAGA 2 cut(s) 57, 137
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 1 cut(s) 203
MnlI CCTC 9 cut(s) 11, 198, 286, 324, 327, 396, 408, 411, 414
MslI CAYNNNNRTG 5 cut(s) 134, 177, 195, 251, 294
MspI CCGG 2 cut(s) 432, 444
MspR9I CCNGG 3 cut(s) 73, 162, 369
MvaI CCWGG 3 cut(s) 73, 162, 369
MwoI GCNNNNNNNGC 3 cut(s) 164, 281, 432
NcoI CCATGG 2 cut(s) 135, 252
NdeII GATC 5 cut(s) 94, 111, 181, 298, 394
NlaIII CATG 9 cut(s) 101, 133, 139, 182, 250, 256, 299, 395, 468
NmuCI GTSAC 2 cut(s) 221, 446
NspI RCATGY 1 cut(s) 133
PagI TCATGA 1 cut(s) 97
PciI ACATGT 1 cut(s) 129
PciSI GCTCTTC 1 cut(s) 70
PcsI WCGNNNNNNNCGW 4 cut(s) 213, 225, 234, 357
PfeI GAWTC 2 cut(s) 239, 332
PinAI ACCGGT 1 cut(s) 443
PscI ACATGT 1 cut(s) 129
PsiI TTATAA 1 cut(s) 420
Psp6I CCWGG 3 cut(s) 71, 160, 367
PspGI CCWGG 3 cut(s) 71, 160, 367
PspPI GGNCC 1 cut(s) 371
RsaI GTAC 2 cut(s) 141, 354
RsaNI GTAC 2 cut(s) 140, 353
RseI CAYNNNNRTG 5 cut(s) 134, 177, 195, 251, 294
SalI GTCGAC 2 cut(s) 24, 215
SapI GCTCTTC 1 cut(s) 70
Sau3AI GATC 5 cut(s) 94, 111, 181, 298, 394
Sau96I GGNCC 1 cut(s) 371
ScrFI CCNGG 3 cut(s) 73, 162, 369
SduI GDGCHC 1 cut(s) 122
SetI ASST 2 cut(s) 65, 166
SmiMI CAYNNNNRTG 5 cut(s) 134, 177, 195, 251, 294
SmlI CTYRAG 2 cut(s) 58, 277
SmoI CTYRAG 2 cut(s) 58, 277
Sse9I AATT 1 cut(s) 203
SsiI CCGC 1 cut(s) 320
SspMI CTAG 4 cut(s) 143, 168, 285, 356
StyD4I CCNGG 3 cut(s) 71, 160, 367
StyI CCWWGG 2 cut(s) 135, 252
TaaI ACNGT 3 cut(s) 30, 221, 345
TaqI TCGA 4 cut(s) 25, 216, 292, 388
TasI AATT 1 cut(s) 203
TfiI GAWTC 2 cut(s) 239, 332
TseFI GTSAC 2 cut(s) 221, 446
Tsp45I GTSAC 2 cut(s) 221, 446
TspGWI ACGGA 2 cut(s) 137, 232
XagI CCTNNNNNAGG 1 cut(s) 159
XapI RAATTY 1 cut(s) 203
XceI RCATGY 1 cut(s) 133
XmiI GTMKAC 2 cut(s) 25, 216
XspI CTAG 4 cut(s) 143, 168, 285, 356
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.