Rh5DG489500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
76911212 .. 76912812
1601 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG489500.1

Sequence Viewer

Length: 246 bp
ATGGGATTTGGAGGTATTCGGCTGTGCTTGTCTCTCTTGCTGGCTTTTGCTGTAGTCTCTTCTGCTTCCAGGAACACCATTGATCCACTTTCAGTTTCAGATAATGACGAAATGGTAATGACGATGGAGGGGAGGTCTTTGATGGCGAGACTAGACGACTACGGTGACACGACTGCGAATCGTGGACATGATCCGCCATCTGCCTCCAAGGTCAAACCCGGCAAACTCCGTGGCCGAAAGGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.64

Weight (kDa)

9.03

Isoelectric Point (pI)

21.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 194
AclWI GGATC 2 cut(s) 77, 185
AcoI YGGCCR 1 cut(s) 232
AjnI CCWGG 1 cut(s) 68
Alw26I GTCTC 3 cut(s) 36, 61, 142
AlwI GGATC 2 cut(s) 77, 185
AoxI GGCC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 219
AsuHPI GGTGA 1 cut(s) 176
BccI CCATC 3 cut(s) 118, 136, 205
BciT130I CCWGG 1 cut(s) 70
BcnI CCSGG 1 cut(s) 219
BcoDI GTCTC 3 cut(s) 36, 61, 142
BfaI CTAG 2 cut(s) 152, 244
BfmI CTRYAG 1 cut(s) 51
BglI GCCNNNNNGGC 1 cut(s) 240
Bme1390I CCNGG 2 cut(s) 70, 219
BmrFI CCNGG 2 cut(s) 70, 219
BpuMI CCSGG 1 cut(s) 219
BsaJI CCNNGG 2 cut(s) 207, 229
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 2 cut(s) 207, 229
BshFI GGCC 1 cut(s) 234
BsiSI CCGG 1 cut(s) 219
BsmAI GTCTC 3 cut(s) 36, 61, 142
BsnI GGCC 1 cut(s) 234
Bsp143I GATC 2 cut(s) 82, 190
BspACI CCGC 1 cut(s) 194
BspANI GGCC 1 cut(s) 234
BspPI GGATC 2 cut(s) 77, 185
BssECI CCNNGG 2 cut(s) 207, 229
BssMI GATC 2 cut(s) 82, 190
BssT1I CCWWGG 1 cut(s) 207
Bst2UI CCWGG 1 cut(s) 70
Bst4CI ACNGT 1 cut(s) 164
Bst6I CTCTTC 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 42
BstDSI CCRYGG 1 cut(s) 229
BstKTI GATC 2 cut(s) 85, 193
BstMAI GTCTC 3 cut(s) 36, 61, 142
BstMBI GATC 2 cut(s) 82, 190
BstMWI GCNNNNNNNGC 1 cut(s) 240
BstNI CCWGG 1 cut(s) 70
BstSCI CCNGG 2 cut(s) 68, 217
BstSFI CTRYAG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 234
BtgI CCRYGG 1 cut(s) 229
Cac8I GCNNGC 1 cut(s) 42
CspCI CAANNNNNGTGG 2 cut(s) 211, 246
CviAII CATG 1 cut(s) 188
CviJI RGCY 4 cut(s) 22, 44, 234, 243
CviKI_1 RGCY 4 cut(s) 22, 44, 234, 243
DpnI GATC 2 cut(s) 84, 192
DpnII GATC 2 cut(s) 82, 190
EaeI YGGCCR 1 cut(s) 232
Eam1104I CTCTTC 1 cut(s) 64
EarI CTCTTC 1 cut(s) 64
EciI GGCGGA 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 207
ErhI CCWWGG 1 cut(s) 207
FaeI CATG 1 cut(s) 191
FaiI YATR 1 cut(s) 189
FatI CATG 1 cut(s) 187
FspBI CTAG 2 cut(s) 152, 244
HaeIII GGCC 1 cut(s) 234
HapII CCGG 1 cut(s) 219
Hin1II CATG 1 cut(s) 191
HinfI GANTC 1 cut(s) 178
HpaII CCGG 1 cut(s) 219
HphI GGTGA 1 cut(s) 176
Hpy166II GTNNAC 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 240
Hsp92II CATG 1 cut(s) 191
Kzo9I GATC 2 cut(s) 82, 190
LpnPI CCDG 4 cut(s) 26, 55, 82, 232
MaeI CTAG 2 cut(s) 152, 244
MaeIII GTNAC 1 cut(s) 164
MalI GATC 2 cut(s) 84, 192
MboI GATC 2 cut(s) 82, 190
MboII GAAGA 1 cut(s) 51
MnlI CCTC 4 cut(s) 5, 121, 126, 214
MspI CCGG 1 cut(s) 219
MspR9I CCNGG 2 cut(s) 70, 219
MvaI CCWGG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 240
NciI CCSGG 1 cut(s) 219
NdeII GATC 2 cut(s) 82, 190
NlaIII CATG 1 cut(s) 191
NmuCI GTSAC 1 cut(s) 164
PfeI GAWTC 1 cut(s) 178
PfoI TCCNGGA 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
Sau3AI GATC 2 cut(s) 82, 190
ScrFI CCNGG 2 cut(s) 70, 219
SetI ASST 3 cut(s) 16, 137, 213
SfcI CTRYAG 1 cut(s) 51
SsiI CCGC 1 cut(s) 194
SspMI CTAG 2 cut(s) 152, 244
StyD4I CCNGG 2 cut(s) 68, 217
StyI CCWWGG 1 cut(s) 207
TaaI ACNGT 1 cut(s) 164
TfiI GAWTC 1 cut(s) 178
TseFI GTSAC 1 cut(s) 164
Tsp45I GTSAC 1 cut(s) 164
TspGWI ACGGA 1 cut(s) 218
XspI CTAG 2 cut(s) 152, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.