Rh5DG489600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0007230
Physical Location & Seq
Reverse (-)
76916837 .. 76917430
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG489600.1

Sequence Viewer

Length: 264 bp
ATGAATATGAATATGGGCTTTGGAGGAAGTCGAGTGTGCATGTTTCTCTTGCTTGTCTATGCCTTAAGCTCTTCTGCCAGGAACTTGATTCCATTTCCAGATCGTGAGATGGTAGTGATCAAGAGCACGGAGGGCATATCCATGGGACTAGACGACTATCCTGACCCAGGTCCTAATCCTCGACATGATCCGCCCCCTTCTCATCCCGCTCCCCCTAATGGCAAATCCGGCAAAGTTGACGGTGACAAGGATGATGGTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.28

Weight (kDa)

5.06

Isoelectric Point (pI)

33.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 209
AciI CCGC 2 cut(s) 191, 207
AclWI GGATC 1 cut(s) 182
AfiI CCNNNNNNNGG 2 cut(s) 167, 218
AflII CTTAAG 1 cut(s) 64
AjnI CCWGG 2 cut(s) 77, 166
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
Alw21I GWGCWC 1 cut(s) 128
AlwI GGATC 1 cut(s) 182
AspS9I GGNCC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 254
AvaII GGWCC 1 cut(s) 170
Bbv12I GWGCWC 1 cut(s) 128
BccI CCATC 2 cut(s) 103, 248
BciT130I CCWGG 2 cut(s) 79, 168
BclI TGATCA 1 cut(s) 117
BfaI CTAG 1 cut(s) 149
BfrI CTTAAG 1 cut(s) 64
Bme1390I CCNGG 2 cut(s) 79, 168
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmrFI CCNGG 2 cut(s) 79, 168
BoxI GACNNNNGTC 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 141, 166
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 218
BseBI CCWGG 2 cut(s) 79, 168
BseDI CCNNGG 2 cut(s) 141, 166
BseGI GGATG 2 cut(s) 202, 256
BseLI CCNNNNNNNGG 2 cut(s) 167, 218
BsiHKAI GWGCWC 1 cut(s) 128
BsiSI CCGG 1 cut(s) 228
BslFI GGGAC 1 cut(s) 159
BslI CCNNNNNNNGG 2 cut(s) 167, 218
BsmFI GGGAC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 128
Bsp143I GATC 3 cut(s) 100, 117, 187
Bsp19I CCATGG 1 cut(s) 141
BspACI CCGC 2 cut(s) 191, 207
BspPI GGATC 1 cut(s) 182
BspQI GCTCTTC 1 cut(s) 76
BspTI CTTAAG 1 cut(s) 64
BsrBI CCGCTC 1 cut(s) 209
BssECI CCNNGG 2 cut(s) 141, 166
BssMI GATC 3 cut(s) 100, 117, 187
BssT1I CCWWGG 1 cut(s) 141
Bst2UI CCWGG 2 cut(s) 79, 168
Bst4CI ACNGT 1 cut(s) 242
Bst6I CTCTTC 1 cut(s) 76
BstAFI CTTAAG 1 cut(s) 64
BstDSI CCRYGG 1 cut(s) 141
BstENI CCTNNNNNAGG 1 cut(s) 165
BstF5I GGATG 2 cut(s) 202, 256
BstKTI GATC 3 cut(s) 103, 120, 190
BstMBI GATC 3 cut(s) 100, 117, 187
BstMWI GCNNNNNNNGC 2 cut(s) 132, 228
BstNI CCWGG 2 cut(s) 79, 168
BstNSI RCATGY 1 cut(s) 43
BstPAI GACNNNNGTC 1 cut(s) 168
BstSCI CCNGG 2 cut(s) 77, 166
BtgI CCRYGG 1 cut(s) 141
BtsCI GGATG 2 cut(s) 202, 256
Cfr13I GGNCC 1 cut(s) 170
CviAII CATG 4 cut(s) 40, 142, 185, 261
CviJI RGCY 2 cut(s) 18, 69
CviKI_1 RGCY 2 cut(s) 18, 69
DpnI GATC 3 cut(s) 102, 119, 189
DpnII GATC 3 cut(s) 100, 117, 187
Eam1104I CTCTTC 1 cut(s) 76
EarI CTCTTC 1 cut(s) 76
EciI GGCGGA 1 cut(s) 180
Eco130I CCWWGG 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 170
EcoNI CCTNNNNNAGG 1 cut(s) 165
EcoO109I RGGNCCY 1 cut(s) 170
EcoRII CCWGG 2 cut(s) 77, 166
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 4 cut(s) 43, 145, 188, 264
FaiI YATR 8 cut(s) 8, 14, 41, 60, 137, 143, 186, 262
FaqI GGGAC 1 cut(s) 159
FatI CATG 4 cut(s) 39, 141, 184, 260
FauI CCCGC 1 cut(s) 214
FbaI TGATCA 1 cut(s) 117
FokI GGATG 1 cut(s) 189
FspBI CTAG 1 cut(s) 149
HapII CCGG 1 cut(s) 228
Hin1II CATG 4 cut(s) 43, 145, 188, 264
HincII GTYRAC 1 cut(s) 238
HindII GTYRAC 1 cut(s) 238
HinfI GANTC 1 cut(s) 88
HpaII CCGG 1 cut(s) 228
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 1 cut(s) 238
Hpy188III TCNNGA 4 cut(s) 98, 104, 121, 161
Hpy8I GTNNAC 1 cut(s) 238
HpyAV CCTTC 1 cut(s) 207
HpyCH4III ACNGT 1 cut(s) 242
HpyCH4V TGCA 2 cut(s) 39, 260
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 228
Hsp92II CATG 4 cut(s) 43, 145, 188, 264
Ksp22I TGATCA 1 cut(s) 117
Kzo9I GATC 3 cut(s) 100, 117, 187
LguI GCTCTTC 1 cut(s) 76
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 7 cut(s) 64, 91, 111, 153, 174, 180, 241
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 242
MalI GATC 3 cut(s) 102, 119, 189
MbiI CCGCTC 1 cut(s) 209
MboI GATC 3 cut(s) 100, 117, 187
MboII GAAGA 1 cut(s) 63
MhlI GDGCHC 1 cut(s) 128
MnlI CCTC 3 cut(s) 17, 124, 189
MseI TTAA 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 140
MspCI CTTAAG 1 cut(s) 64
MspI CCGG 1 cut(s) 228
MspR9I CCNGG 2 cut(s) 79, 168
MvaI CCWGG 2 cut(s) 79, 168
MwoI GCNNNNNNNGC 2 cut(s) 132, 228
NcoI CCATGG 1 cut(s) 141
NdeII GATC 3 cut(s) 100, 117, 187
NlaIII CATG 4 cut(s) 43, 145, 188, 264
NmuCI GTSAC 1 cut(s) 242
NspI RCATGY 1 cut(s) 43
PciSI GCTCTTC 1 cut(s) 76
PfeI GAWTC 1 cut(s) 88
PpuMI RGGWCCY 1 cut(s) 170
PshAI GACNNNNGTC 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 170
Psp6I CCWGG 2 cut(s) 77, 166
PspGI CCWGG 2 cut(s) 77, 166
PspPI GGNCC 1 cut(s) 170
PspPPI RGGWCCY 1 cut(s) 170
RseI CAYNNNNRTG 1 cut(s) 140
SapI GCTCTTC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 3 cut(s) 100, 117, 187
Sau96I GGNCC 1 cut(s) 170
ScrFI CCNGG 2 cut(s) 79, 168
SduI GDGCHC 1 cut(s) 128
SetI ASST 2 cut(s) 71, 172
SinI GGWCC 1 cut(s) 170
SmiMI CAYNNNNRTG 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 64
SmoI CTYRAG 1 cut(s) 64
SsiI CCGC 2 cut(s) 191, 207
SspMI CTAG 1 cut(s) 149
StyD4I CCNGG 2 cut(s) 77, 166
StyI CCWWGG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 242
TaqI TCGA 2 cut(s) 31, 181
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TseFI GTSAC 1 cut(s) 242
Tsp45I GTSAC 1 cut(s) 242
TspDTI ATGAA 2 cut(s) 17, 23
TspGWI ACGGA 1 cut(s) 143
Vha464I CTTAAG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 170
XagI CCTNNNNNAGG 1 cut(s) 165
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.