Rh5CG501300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0007230
Physical Location & Seq
Reverse (-)
69685643 .. 69687626
1984 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG501300.1

Sequence Viewer

Length: 267 bp
ATGAATATGAGTATGGGCTTTGGAGGAAGTCGAGTGTGCATGTTTCTCTTGCTTGTCTATGCCTTAAGCTCTACTGCCAGGAACTTGATTGCATTTCCAGATCGTGAGATGGTAGTGATCAAGAGCACGGAGGGCATATCCATGGGACTAGACGACTATCCTGACCCAGGTCCTAATCCTCGACATGATCCGTCCCCTTCTCATCCCCCTCCCCTAATGGCAAATCCGGCAAAGTTGACGTGGCCTAAAGTCAAAGATAAAGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.61

Weight (kDa)

7.91

Isoelectric Point (pI)

41.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AfiI CCNNNNNNNGG 1 cut(s) 167
AflII CTTAAG 1 cut(s) 64
AjiI CACGTC 1 cut(s) 240
AjnI CCWGG 2 cut(s) 77, 166
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
Alw21I GWGCWC 1 cut(s) 128
AlwI GGATC 1 cut(s) 182
AoxI GGCC 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 170
AvaII GGWCC 1 cut(s) 170
Bbv12I GWGCWC 1 cut(s) 128
BccI CCATC 1 cut(s) 103
BciT130I CCWGG 2 cut(s) 79, 168
BclI TGATCA 1 cut(s) 117
BfaI CTAG 1 cut(s) 149
BfrI CTTAAG 1 cut(s) 64
Bme1390I CCNGG 2 cut(s) 79, 168
Bme18I GGWCC 1 cut(s) 170
BmgBI CACGTC 1 cut(s) 240
BmgT120I GGNCC 1 cut(s) 170
BmrFI CCNGG 2 cut(s) 79, 168
BoxI GACNNNNGTC 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 141, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseBI CCWGG 2 cut(s) 79, 168
BseDI CCNNGG 2 cut(s) 141, 166
BseGI GGATG 1 cut(s) 202
BseLI CCNNNNNNNGG 1 cut(s) 167
BshFI GGCC 1 cut(s) 244
BsiHKAI GWGCWC 1 cut(s) 128
BsiSI CCGG 1 cut(s) 227
BslFI GGGAC 2 cut(s) 159, 178
BslI CCNNNNNNNGG 1 cut(s) 167
BsmFI GGGAC 2 cut(s) 159, 178
BsnI GGCC 1 cut(s) 244
Bsp1286I GDGCHC 1 cut(s) 128
Bsp143I GATC 3 cut(s) 100, 117, 187
Bsp19I CCATGG 1 cut(s) 141
BspANI GGCC 1 cut(s) 244
BspPI GGATC 1 cut(s) 182
BspTI CTTAAG 1 cut(s) 64
BssECI CCNNGG 2 cut(s) 141, 166
BssMI GATC 3 cut(s) 100, 117, 187
BssT1I CCWWGG 1 cut(s) 141
Bst2UI CCWGG 2 cut(s) 79, 168
BstAFI CTTAAG 1 cut(s) 64
BstDSI CCRYGG 1 cut(s) 141
BstENI CCTNNNNNAGG 1 cut(s) 165
BstF5I GGATG 1 cut(s) 202
BstKTI GATC 3 cut(s) 103, 120, 190
BstMBI GATC 3 cut(s) 100, 117, 187
BstMWI GCNNNNNNNGC 2 cut(s) 132, 227
BstNI CCWGG 2 cut(s) 79, 168
BstNSI RCATGY 1 cut(s) 43
BstPAI GACNNNNGTC 1 cut(s) 168
BstSCI CCNGG 2 cut(s) 77, 166
BsuRI GGCC 1 cut(s) 244
BtgI CCRYGG 1 cut(s) 141
BtrI CACGTC 1 cut(s) 240
BtsCI GGATG 1 cut(s) 202
Cfr13I GGNCC 1 cut(s) 170
CviAII CATG 3 cut(s) 40, 142, 185
CviJI RGCY 3 cut(s) 18, 69, 244
CviKI_1 RGCY 3 cut(s) 18, 69, 244
DpnI GATC 3 cut(s) 102, 119, 189
DpnII GATC 3 cut(s) 100, 117, 187
Eco130I CCWWGG 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 170
EcoNI CCTNNNNNAGG 1 cut(s) 165
EcoO109I RGGNCCY 1 cut(s) 170
EcoRII CCWGG 2 cut(s) 77, 166
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 3 cut(s) 43, 145, 188
FaiI YATR 7 cut(s) 8, 14, 41, 60, 137, 143, 186
FaqI GGGAC 2 cut(s) 159, 178
FatI CATG 3 cut(s) 39, 141, 184
FbaI TGATCA 1 cut(s) 117
FokI GGATG 1 cut(s) 189
FspBI CTAG 1 cut(s) 149
HaeIII GGCC 1 cut(s) 244
HapII CCGG 1 cut(s) 227
Hin1II CATG 3 cut(s) 43, 145, 188
HincII GTYRAC 1 cut(s) 237
HindII GTYRAC 1 cut(s) 237
HpaII CCGG 1 cut(s) 227
Hpy166II GTNNAC 1 cut(s) 237
Hpy188III TCNNGA 4 cut(s) 98, 104, 121, 161
Hpy8I GTNNAC 1 cut(s) 237
HpyAV CCTTC 1 cut(s) 207
HpyCH4IV ACGT 1 cut(s) 239
HpyCH4V TGCA 2 cut(s) 39, 92
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 227
HpySE526I ACGT 1 cut(s) 239
Hsp92II CATG 3 cut(s) 43, 145, 188
Ksp22I TGATCA 1 cut(s) 117
Kzo9I GATC 3 cut(s) 100, 117, 187
LpnPI CCDG 7 cut(s) 64, 91, 111, 153, 174, 180, 240
MaeI CTAG 1 cut(s) 149
MaeII ACGT 1 cut(s) 239
MalI GATC 3 cut(s) 102, 119, 189
MboI GATC 3 cut(s) 100, 117, 187
MhlI GDGCHC 1 cut(s) 128
MnlI CCTC 4 cut(s) 17, 124, 189, 219
MseI TTAA 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 140
MspCI CTTAAG 1 cut(s) 64
MspI CCGG 1 cut(s) 227
MspR9I CCNGG 2 cut(s) 79, 168
MvaI CCWGG 2 cut(s) 79, 168
MwoI GCNNNNNNNGC 2 cut(s) 132, 227
NcoI CCATGG 1 cut(s) 141
NdeII GATC 3 cut(s) 100, 117, 187
NlaIII CATG 3 cut(s) 43, 145, 188
NspI RCATGY 1 cut(s) 43
PpuMI RGGWCCY 1 cut(s) 170
PshAI GACNNNNGTC 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 170
Psp6I CCWGG 2 cut(s) 77, 166
PspGI CCWGG 2 cut(s) 77, 166
PspPI GGNCC 1 cut(s) 170
PspPPI RGGWCCY 1 cut(s) 170
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 3 cut(s) 100, 117, 187
Sau96I GGNCC 1 cut(s) 170
ScrFI CCNGG 2 cut(s) 79, 168
SduI GDGCHC 1 cut(s) 128
SetI ASST 3 cut(s) 71, 172, 242
SinI GGWCC 1 cut(s) 170
SmiMI CAYNNNNRTG 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 64
SmoI CTYRAG 1 cut(s) 64
SspMI CTAG 1 cut(s) 149
StyD4I CCNGG 2 cut(s) 77, 166
StyI CCWWGG 1 cut(s) 141
TaiI ACGT 1 cut(s) 242
TaqI TCGA 2 cut(s) 31, 181
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 143, 180
Vha464I CTTAAG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 170
XagI CCTNNNNNAGG 1 cut(s) 165
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.