RchiOBHm_Chr5g0070101

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0007230
Physical Location & Seq
Reverse (-)
75937828 .. 75939123
1296 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34538

Sequence Viewer

Length: 408 bp
ATGAATATTTGTTCAAATTACTTTGTACGTAATTGCTATCGTCAACTCCTAATTCTAAACCTGCCATATAGTCATATTATTAATTCTCGATTATATTATATTAGGCCTTATATATATGTTTCTCATGTAGGAAGAGAGAGTGAAAAAACAAAGGGAATGAAAATGGGATTTGGAGGTATACGGCTGTGCTTGTCTCTCTTGCTGGCTTTTGCTGTAGTCTCTTCTGCTTTCAGGAACACCATCAATCCATTTTCAGTTTCAGATAACGACGAAATGGTAATGACGATGGAGGGGAGGTCTTTGATGGCGAGACTAGACGACTACGGTGACACGACTGCGAATCGTGGGCATGATCCGCCATCTACCTCCAAGGCCAAACCAGGCAAACTCCGTGGCCGAAAGGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

135

Amino Acids

15.28

Weight (kDa)

9.75

Isoelectric Point (pI)

35.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 69
AccI GTMKAC 1 cut(s) 178
AciI CCGC 1 cut(s) 356
AclWI GGATC 1 cut(s) 347
AcoI YGGCCR 1 cut(s) 394
AfaI GTAC 1 cut(s) 27
AgsI TTSAA 1 cut(s) 15
AjnI CCWGG 1 cut(s) 379
Alw26I GTCTC 3 cut(s) 198, 223, 304
AlwI GGATC 1 cut(s) 347
AoxI GGCC 3 cut(s) 104, 372, 394
AseI ATTAAT 1 cut(s) 81
AsuHPI GGTGA 1 cut(s) 338
BccI CCATC 4 cut(s) 248, 280, 298, 367
BceAI ACGGC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 381
BcoDI GTCTC 3 cut(s) 198, 223, 304
BfaI CTAG 2 cut(s) 314, 406
BfmI CTRYAG 1 cut(s) 213
BfuAI ACCTGC 1 cut(s) 69
BglI GCCNNNNNGGC 1 cut(s) 402
Bme1390I CCNGG 1 cut(s) 381
BmrFI CCNGG 1 cut(s) 381
BsaAI YACGTR 1 cut(s) 29
BsaJI CCNNGG 2 cut(s) 369, 391
BsaXI ACNNNNNCTCC 2 cut(s) 281, 311
BseBI CCWGG 1 cut(s) 381
BseDI CCNNGG 2 cut(s) 369, 391
BshFI GGCC 3 cut(s) 106, 374, 396
BsmAI GTCTC 3 cut(s) 198, 223, 304
BsnI GGCC 3 cut(s) 106, 374, 396
Bsp143I GATC 1 cut(s) 352
BspACI CCGC 1 cut(s) 356
BspANI GGCC 3 cut(s) 106, 374, 396
BspMI ACCTGC 1 cut(s) 69
BspPI GGATC 1 cut(s) 347
BssECI CCNNGG 2 cut(s) 369, 391
BssMI GATC 1 cut(s) 352
BssNAI GTATAC 1 cut(s) 179
BssT1I CCWWGG 1 cut(s) 369
Bst1107I GTATAC 1 cut(s) 179
Bst2UI CCWGG 1 cut(s) 381
Bst4CI ACNGT 1 cut(s) 326
Bst6I CTCTTC 2 cut(s) 127, 226
BstBAI YACGTR 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 204
BstDSI CCRYGG 1 cut(s) 391
BstKTI GATC 1 cut(s) 355
BstMAI GTCTC 3 cut(s) 198, 223, 304
BstMBI GATC 1 cut(s) 352
BstMWI GCNNNNNNNGC 2 cut(s) 355, 402
BstNI CCWGG 1 cut(s) 381
BstSCI CCNGG 1 cut(s) 379
BstSFI CTRYAG 1 cut(s) 213
BstSNI TACGTA 1 cut(s) 29
BstZ17I GTATAC 1 cut(s) 179
BsuRI GGCC 3 cut(s) 106, 374, 396
BtgI CCRYGG 1 cut(s) 391
BveI ACCTGC 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 26
CspCI CAANNNNNGTGG 2 cut(s) 373, 408
CviAII CATG 2 cut(s) 125, 350
CviJI RGCY 6 cut(s) 106, 184, 206, 374, 396, 405
CviKI_1 RGCY 6 cut(s) 106, 184, 206, 374, 396, 405
CviQI GTAC 1 cut(s) 26
DpnI GATC 1 cut(s) 354
DpnII GATC 1 cut(s) 352
EaeI YGGCCR 1 cut(s) 394
Eam1104I CTCTTC 2 cut(s) 127, 226
EarI CTCTTC 2 cut(s) 127, 226
EciI GGCGGA 1 cut(s) 345
Eco105I TACGTA 1 cut(s) 29
Eco130I CCWWGG 1 cut(s) 369
Eco147I AGGCCT 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 379
EcoT14I CCWWGG 1 cut(s) 369
ErhI CCWWGG 1 cut(s) 369
FaeI CATG 2 cut(s) 128, 353
FatI CATG 2 cut(s) 124, 349
FblI GTMKAC 1 cut(s) 178
FspBI CTAG 2 cut(s) 314, 406
HaeIII GGCC 3 cut(s) 106, 374, 396
Hin1II CATG 2 cut(s) 128, 353
HincII GTYRAC 1 cut(s) 44
HindII GTYRAC 1 cut(s) 44
HinfI GANTC 1 cut(s) 340
HphI GGTGA 1 cut(s) 338
Hpy166II GTNNAC 2 cut(s) 44, 179
Hpy188I TCNGA 1 cut(s) 262
Hpy188III TCNNGA 2 cut(s) 87, 232
Hpy8I GTNNAC 2 cut(s) 44, 179
Hpy99I CGWCG 1 cut(s) 272
HpyCH4III ACNGT 1 cut(s) 326
HpyCH4IV ACGT 1 cut(s) 28
HpyF10VI GCNNNNNNNGC 2 cut(s) 355, 402
HpySE526I ACGT 1 cut(s) 28
Hsp92II CATG 2 cut(s) 128, 353
Kzo9I GATC 1 cut(s) 352
LpnPI CCDG 5 cut(s) 74, 188, 217, 366, 393
MaeI CTAG 2 cut(s) 314, 406
MaeII ACGT 1 cut(s) 28
MaeIII GTNAC 1 cut(s) 326
MalI GATC 1 cut(s) 354
MboI GATC 1 cut(s) 352
MboII GAAGA 2 cut(s) 144, 213
MluCI AATT 4 cut(s) 16, 31, 51, 82
MnlI CCTC 4 cut(s) 167, 283, 288, 376
MseI TTAA 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 381
MvaI CCWGG 1 cut(s) 381
MwoI GCNNNNNNNGC 2 cut(s) 355, 402
NdeII GATC 1 cut(s) 352
NlaIII CATG 2 cut(s) 128, 353
NmuCI GTSAC 1 cut(s) 326
PceI AGGCCT 1 cut(s) 106
PfeI GAWTC 1 cut(s) 340
Ppu21I YACGTR 1 cut(s) 29
PshBI ATTAAT 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 379
PspGI CCWGG 1 cut(s) 379
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 352
ScrFI CCNGG 1 cut(s) 381
SetI ASST 5 cut(s) 31, 63, 178, 299, 368
SfcI CTRYAG 1 cut(s) 213
SnaBI TACGTA 1 cut(s) 29
Sse9I AATT 4 cut(s) 16, 31, 51, 82
SseBI AGGCCT 1 cut(s) 106
SsiI CCGC 1 cut(s) 356
SspI AATATT 1 cut(s) 7
SspMI CTAG 2 cut(s) 314, 406
StuI AGGCCT 1 cut(s) 106
StyD4I CCNGG 1 cut(s) 379
StyI CCWWGG 1 cut(s) 369
TaaI ACNGT 1 cut(s) 326
TaiI ACGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 88
TasI AATT 4 cut(s) 16, 31, 51, 82
TfiI GAWTC 1 cut(s) 340
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseFI GTSAC 1 cut(s) 326
Tsp45I GTSAC 1 cut(s) 326
TspDTI ATGAA 2 cut(s) 17, 173
TspGWI ACGGA 1 cut(s) 380
VspI ATTAAT 1 cut(s) 81
XmiI GTMKAC 1 cut(s) 178
XspI CTAG 2 cut(s) 314, 406
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.