FvH4_4g02261

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0004450
Physical Location & Seq
Forward (+)
2103925 .. 2105439
1515 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g02261.t1

Sequence Viewer

Length: 411 bp
ATGATGACAGCTGTCTTGGTAAACAAGAAATTAACTGATGCCTTCAGTGCTCTACCAGGGAGGTATGGAACAAACTCAAGCAAAGGTATGCTTCTGTCTTTAAGGCACATGTTATGTAGCTTAAGACGTCTGAGTTACAAGCAATTCAAAAAGGAAGATGTTAAAGTTTTAATCCTTGATGGTTTACCTATTGAGTATGGTCATACTAGACAGATTATTAGGGGAAAACCTAATATTGATCTAGGTGAGATCAGTTCATTATTGTTGTCTACAGAAAGTGAGATTGAACTTGAACAAAAAGCTTTACCTCTGTCACAATTTTCTACTATGGTTGCACAAAATCAGAATGCCTCAATGCCTAATGTTCTAATGGGGATCAATCTCCTGCACAGGTCTGTAGCAATAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.16

Weight (kDa)

9.37

Isoelectric Point (pI)

50.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 130
AccI GTMKAC 1 cut(s) 269
AclWI GGATC 1 cut(s) 383
AcuI CTGAAG 1 cut(s) 28
AcyI GRCGYC 1 cut(s) 127
AflII CTTAAG 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 108
AgsI TTSAA 3 cut(s) 148, 287, 293
AjnI CCWGG 1 cut(s) 55
AluBI AGCT 3 cut(s) 11, 120, 302
AluI AGCT 3 cut(s) 11, 120, 302
Alw21I GWGCWC 1 cut(s) 52
AlwI GGATC 1 cut(s) 383
AsuHPI GGTGA 1 cut(s) 257
Bbv12I GWGCWC 1 cut(s) 52
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 57
BfaI CTAG 2 cut(s) 207, 242
BfmI CTRYAG 2 cut(s) 270, 396
BfrI CTTAAG 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 57
BmsI GCATC 1 cut(s) 28
BoxI GACNNNNGTC 1 cut(s) 11
BpuEI CTTGAG 1 cut(s) 61
BsaHI GRCGYC 1 cut(s) 127
BsaJI CCNNGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 56
BseMII CTCAG 1 cut(s) 122
BsgI GTGCAG 1 cut(s) 371
BsiHKAI GWGCWC 1 cut(s) 52
BsmI GAATGC 1 cut(s) 352
Bsp1286I GDGCHC 1 cut(s) 52
Bsp143I GATC 3 cut(s) 238, 249, 375
BspCNI CTCAG 1 cut(s) 123
BspPI GGATC 1 cut(s) 383
BspTI CTTAAG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 3 cut(s) 238, 249, 375
BssNI GRCGYC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 57
BstACI GRCGYC 1 cut(s) 127
BstAFI CTTAAG 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 3 cut(s) 241, 252, 378
BstMBI GATC 3 cut(s) 238, 249, 375
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstNI CCWGG 1 cut(s) 57
BstNSI RCATGY 1 cut(s) 112
BstPAI GACNNNNGTC 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 55
BstSFI CTRYAG 2 cut(s) 270, 396
BtsIMutI CAGTG 1 cut(s) 52
CviAII CATG 1 cut(s) 109
CviJI RGCY 3 cut(s) 11, 120, 302
CviKI_1 RGCY 3 cut(s) 11, 120, 302
DdeI CTNAG 1 cut(s) 131
DpnI GATC 3 cut(s) 240, 251, 377
DpnII GATC 3 cut(s) 238, 249, 375
Eco57I CTGAAG 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 55
FaeI CATG 1 cut(s) 112
FaiI YATR 7 cut(s) 66, 89, 110, 115, 198, 204, 329
FalI AAGNNNNNCTT 2 cut(s) 75, 107
FatI CATG 1 cut(s) 108
FblI GTMKAC 1 cut(s) 269
FspBI CTAG 2 cut(s) 207, 242
Hin1I GRCGYC 1 cut(s) 127
Hin1II CATG 1 cut(s) 112
HindIII AAGCTT 1 cut(s) 300
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 3 cut(s) 22, 185, 270
Hpy188I TCNGA 2 cut(s) 132, 345
Hpy8I GTNNAC 3 cut(s) 22, 185, 270
HpyAV CCTTC 1 cut(s) 52
HpyCH4IV ACGT 1 cut(s) 127
HpyCH4V TGCA 2 cut(s) 335, 388
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 131
HpySE526I ACGT 1 cut(s) 127
Hsp92I GRCGYC 1 cut(s) 127
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 3 cut(s) 238, 249, 375
LpnPI CCDG 4 cut(s) 42, 69, 376, 398
LweI GCATC 1 cut(s) 28
MaeI CTAG 2 cut(s) 207, 242
MaeII ACGT 1 cut(s) 127
MaeIII GTNAC 2 cut(s) 134, 312
MalI GATC 3 cut(s) 240, 251, 377
MboI GATC 3 cut(s) 238, 249, 375
MboII GAAGA 1 cut(s) 167
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 3 cut(s) 29, 143, 317
MnlI CCTC 3 cut(s) 54, 318, 361
MseI TTAA 5 cut(s) 32, 101, 122, 162, 170
MspA1I CMGCKG 1 cut(s) 11
MspCI CTTAAG 1 cut(s) 121
MspR9I CCNGG 1 cut(s) 57
Mva1269I GAATGC 1 cut(s) 352
MvaI CCWGG 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 47
NdeII GATC 3 cut(s) 238, 249, 375
NlaIII CATG 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 312
NspI RCATGY 1 cut(s) 112
PciI ACATGT 1 cut(s) 108
PctI GAATGC 1 cut(s) 352
PscI ACATGT 1 cut(s) 108
PshAI GACNNNNGTC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 55
PspGI CCWGG 1 cut(s) 55
PvuII CAGCTG 1 cut(s) 11
SaqAI TTAA 5 cut(s) 32, 101, 122, 162, 170
Sau3AI GATC 3 cut(s) 238, 249, 375
ScrFI CCNGG 1 cut(s) 57
SduI GDGCHC 1 cut(s) 52
SfaNI GCATC 1 cut(s) 28
SfcI CTRYAG 2 cut(s) 270, 396
SmlI CTYRAG 2 cut(s) 76, 121
SmoI CTYRAG 2 cut(s) 76, 121
Sse9I AATT 3 cut(s) 29, 143, 317
SspI AATATT 1 cut(s) 235
SspMI CTAG 2 cut(s) 207, 242
StyD4I CCNGG 1 cut(s) 55
TaiI ACGT 1 cut(s) 130
TasI AATT 3 cut(s) 29, 143, 317
Tru1I TTAA 5 cut(s) 32, 101, 122, 162, 170
Tru9I TTAA 5 cut(s) 32, 101, 122, 162, 170
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 1 cut(s) 312
Tsp45I GTSAC 1 cut(s) 312
TspDTI ATGAA 1 cut(s) 246
TspRI CASTG 1 cut(s) 52
Vha464I CTTAAG 1 cut(s) 121
XceI RCATGY 1 cut(s) 112
XmiI GTMKAC 1 cut(s) 269
XspI CTAG 2 cut(s) 207, 242
ZraI GACGTC 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.