Rroxscaffold_7G00190440

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
30551103 .. 30551971
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00190440.1

Sequence Viewer

Length: 207 bp
ATGCAGCAATCTAATTTTCAGCCAAATGATTGCTTTATGCCAAATGGAGTTGTATATAATGCTTTTGGGATTGGATATCATAATGCATATGATACTGGTGCTGTGGTGAGTGATAGAAAATATATGTTTGCTTCTAGAACGAAAGAAATGGAAAACAAGAAAGAGTTGCTTACAATTGGGAAAGACAGATTGGCATCGAAACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.74

Weight (kDa)

8.82

Isoelectric Point (pI)

31.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 173, 205
ApeKI GCWGC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 118
BbvI GCAGC 1 cut(s) 16
BfaI CTAG 1 cut(s) 135
BfmI CTRYAG 1 cut(s) 203
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
BmsI GCATC 1 cut(s) 203
BsaBI GATNNNNATC 1 cut(s) 193
Bse1I ACTGG 1 cut(s) 100
Bse8I GATNNNNATC 1 cut(s) 193
BseJI GATNNNNATC 1 cut(s) 193
BseNI ACTGG 1 cut(s) 100
BseXI GCAGC 1 cut(s) 16
BsrI ACTGG 1 cut(s) 100
BstSFI CTRYAG 1 cut(s) 203
BstV1I GCAGC 1 cut(s) 16
CviJI RGCY 1 cut(s) 22
CviKI_1 RGCY 1 cut(s) 22
Eco32I GATATC 1 cut(s) 77
EcoRV GATATC 1 cut(s) 77
EcoT22I ATGCAT 1 cut(s) 88
FaiI YATR 9 cut(s) 38, 55, 57, 81, 88, 90, 123, 125, 205
FalI AAGNNNNNCTT 2 cut(s) 153, 185
FauNDI CATATG 1 cut(s) 88
Fnu4HI GCNGC 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 1 cut(s) 135
GluI GCNGC 1 cut(s) 5
HphI GGTGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 4, 86
LpnPI CCDG 1 cut(s) 81
Lsp1109I GCAGC 1 cut(s) 16
LweI GCATC 1 cut(s) 203
MaeI CTAG 1 cut(s) 135
MfeI CAATTG 1 cut(s) 174
MluCI AATT 2 cut(s) 13, 174
Mph1103I ATGCAT 1 cut(s) 88
MunI CAATTG 1 cut(s) 174
NdeI CATATG 1 cut(s) 88
NsiI ATGCAT 1 cut(s) 88
PkrI GCNGC 1 cut(s) 6
SatI GCNGC 1 cut(s) 5
SfaNI GCATC 1 cut(s) 203
SfcI CTRYAG 1 cut(s) 203
SgeI CNNG 3 cut(s) 108, 147, 169
Sse9I AATT 2 cut(s) 13, 174
SspMI CTAG 1 cut(s) 135
TaqI TCGA 1 cut(s) 197
TasI AATT 2 cut(s) 13, 174
TseI GCWGC 1 cut(s) 4
XbaI TCTAGA 1 cut(s) 134
XspI CTAG 1 cut(s) 135
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.