RchiOBHm_Chr6g0277021

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
39362899 .. 39363987
1089 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24851

Sequence Viewer

Length: 192 bp
ATGCGTTTGGTAGAGATAGCCAATCTAGAAGTTCTTCTCCATAGAAATCTCTCATTGTGTTGTCACATCCCCATAGTCGGAGATTTCTGTGGAGAACAACTCTTAAGTTGGGTATTACATGTTGCCTTTCCTACCAGGCACTTTGAAAACCGATTGGCATTGTGGTTCCTAAATTCCTTGTTTAGGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.42

Weight (kDa)

6.89

Isoelectric Point (pI)

32.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 172
AfiI CCNNNNNNNGG 2 cut(s) 77, 183
AflII CTTAAG 1 cut(s) 103
AflIII ACRYGT 1 cut(s) 118
AgsI TTSAA 1 cut(s) 146
AjnI CCWGG 1 cut(s) 134
ApoI RAATTY 1 cut(s) 172
Asp700I GAANNNNTTC 1 cut(s) 33
BciT130I CCWGG 1 cut(s) 136
BfaI CTAG 1 cut(s) 26
BfrI CTTAAG 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 136
BplI GAGNNNNNCTC 2 cut(s) 84, 116
Bsc4I CCNNNNNNNGG 2 cut(s) 77, 183
BseBI CCWGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 66
BseLI CCNNNNNNNGG 2 cut(s) 77, 183
BslI CCNNNNNNNGG 2 cut(s) 77, 183
BspLI GGNNCC 1 cut(s) 167
BspTI CTTAAG 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 136
BstAFI CTTAAG 1 cut(s) 103
BstENI CCTNNNNNAGG 1 cut(s) 181
BstF5I GGATG 1 cut(s) 66
BstNI CCWGG 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 134
BtsCI GGATG 1 cut(s) 66
CviAII CATG 1 cut(s) 119
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
EcoNI CCTNNNNNAGG 1 cut(s) 181
EcoRII CCWGG 1 cut(s) 134
FaeI CATG 1 cut(s) 122
FaiI YATR 3 cut(s) 42, 74, 120
FatI CATG 1 cut(s) 118
FokI GGATG 1 cut(s) 53
FspBI CTAG 1 cut(s) 26
Hin1II CATG 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 80
Hpy188III TCNNGA 1 cut(s) 26
Hsp92II CATG 1 cut(s) 122
LpnPI CCDG 2 cut(s) 121, 148
MaeI CTAG 1 cut(s) 26
MaeIII GTNAC 1 cut(s) 62
MboII GAAGA 1 cut(s) 26
MluCI AATT 2 cut(s) 172, 187
MmeI TCCRAC 1 cut(s) 58
MroXI GAANNNNTTC 1 cut(s) 33
MseI TTAA 1 cut(s) 104
MspCI CTTAAG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 136
MvaI CCWGG 1 cut(s) 136
NlaIII CATG 1 cut(s) 122
NlaIV GGNNCC 1 cut(s) 167
NmuCI GTSAC 1 cut(s) 62
NspI RCATGY 1 cut(s) 122
PciI ACATGT 1 cut(s) 118
PdmI GAANNNNTTC 1 cut(s) 33
PscI ACATGT 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 134
PspGI CCWGG 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 104
ScrFI CCNGG 1 cut(s) 136
SgeI CNNG 4 cut(s) 38, 131, 147, 148
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
Sse9I AATT 2 cut(s) 172, 187
SspMI CTAG 1 cut(s) 26
StyD4I CCNGG 1 cut(s) 134
TasI AATT 2 cut(s) 172, 187
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
Vha464I CTTAAG 1 cut(s) 103
XagI CCTNNNNNAGG 1 cut(s) 181
XapI RAATTY 1 cut(s) 172
XbaI TCTAGA 1 cut(s) 25
XceI RCATGY 1 cut(s) 122
XmnI GAANNNNTTC 1 cut(s) 33
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.