Rroxscaffold_6G00405510

RNA recognition motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0004450
Physical Location & Seq
Reverse (-)
27943904 .. 27957634
13731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00405510.1

Sequence Viewer

Length: 483 bp
ATGCCTTGTCGAGGTCAAAATGCTCATTTTGGGTTCAAACAAGTCCATAATATATATTCAGCAAGCAGTACAAAAACGAAACACCCCTATGAGGTTGATAGAATGAATCGTTCCTTAGGGAACCCTAAACACCTATTCGGAACAAGAATAAGATCTAGGAAACCCCAAATCTTGGATAGCAGTGGACATGGTGAGGCTAAAAATACAATTCACTCCTCAGCAGATGTAGTTTTGTTTCCAGATGAAAGTTTGGTCCAAACTTTGGAAGCATTCATAGATTCTCACAACAATGAGAAAAAGGTTACAGAAACTACAGCTTCCAATATAATATGGAAAAGAATTTCCAAGGATATAGATCAATCGGGAATCAAACCCGAGTCACATAGGCAACTTGAGTCATCTTCGGTTGGACAATTTGTTGATTTTGCTATATTCTTTTTAAGTTCAAACTGTGAGTACTTTGCCAAACCATTTGTGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

160

Amino Acids

18.06

Weight (kDa)

8.91

Isoelectric Point (pI)

40.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 172, 262
AcsI RAATTY 1 cut(s) 339
AfaI GTAC 2 cut(s) 70, 458
AfiI CCNNNNNNNGG 4 cut(s) 11, 91, 172, 262
AgsI TTSAA 2 cut(s) 37, 447
AluBI AGCT 1 cut(s) 317
AluI AGCT 1 cut(s) 317
Ama87I CYCGRG 1 cut(s) 374
ApoI RAATTY 1 cut(s) 339
AspS9I GGNCC 1 cut(s) 253
AsuHPI GGTGA 1 cut(s) 203
AvaI CYCGRG 1 cut(s) 374
AvaII GGWCC 1 cut(s) 253
AxyI CCTNAGG 1 cut(s) 115
BbvCI CCTCAGC 1 cut(s) 217
BfaI CTAG 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 312
BglII AGATCT 1 cut(s) 152
BmcAI AGTACT 1 cut(s) 458
Bme18I GGWCC 1 cut(s) 253
BmeT110I CYCGRG 1 cut(s) 374
BmgT120I GGNCC 1 cut(s) 253
BmiI GGNNCC 1 cut(s) 122
Bpu10I CCTNAGC 1 cut(s) 217
BpuEI CTTGAG 1 cut(s) 413
BsaBI GATNNNNATC 1 cut(s) 354
BsaJI CCNNGG 1 cut(s) 345
Bsc4I CCNNNNNNNGG 4 cut(s) 11, 91, 172, 262
Bse21I CCTNAGG 1 cut(s) 115
Bse8I GATNNNNATC 1 cut(s) 354
BseDI CCNNGG 1 cut(s) 345
BseJI GATNNNNATC 1 cut(s) 354
BseLI CCNNNNNNNGG 4 cut(s) 11, 91, 172, 262
BseMII CTCAG 1 cut(s) 231
BseRI GAGGAG 1 cut(s) 205
BsiHKCI CYCGRG 1 cut(s) 374
BslI CCNNNNNNNGG 4 cut(s) 11, 91, 172, 262
BsmI GAATGC 1 cut(s) 269
BsoBI CYCGRG 1 cut(s) 374
Bsp143I GATC 2 cut(s) 152, 355
BspCNI CTCAG 1 cut(s) 230
BspLI GGNNCC 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 345
BssMI GATC 2 cut(s) 152, 355
BssT1I CCWWGG 1 cut(s) 345
Bst4CI ACNGT 1 cut(s) 452
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 2 cut(s) 115, 217
BstENI CCTNNNNNAGG 1 cut(s) 9
BstKTI GATC 2 cut(s) 155, 358
BstMBI GATC 2 cut(s) 152, 355
BstSFI CTRYAG 1 cut(s) 312
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
Bsu36I CCTNAGG 1 cut(s) 115
BtsI GCAGTG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 187
Cac8I GCNNGC 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 2 cut(s) 69, 457
CviAII CATG 1 cut(s) 188
CviJI RGCY 2 cut(s) 197, 317
CviKI_1 RGCY 2 cut(s) 197, 317
CviQI GTAC 2 cut(s) 69, 457
DdeI CTNAG 2 cut(s) 115, 217
DpnI GATC 2 cut(s) 154, 357
DpnII GATC 2 cut(s) 152, 355
Eco130I CCWWGG 1 cut(s) 345
Eco47I GGWCC 1 cut(s) 253
Eco81I CCTNAGG 1 cut(s) 115
Eco88I CYCGRG 1 cut(s) 374
EcoNI CCTNNNNNAGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 345
ErhI CCWWGG 1 cut(s) 345
FaeI CATG 1 cut(s) 191
FatI CATG 1 cut(s) 187
FspBI CTAG 1 cut(s) 156
Hin1II CATG 1 cut(s) 191
HinfI GANTC 5 cut(s) 106, 278, 366, 377, 395
HphI GGTGA 1 cut(s) 203
Hpy166II GTNNAC 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 2 cut(s) 239, 363
Hpy8I GTNNAC 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 452
HpyF3I CTNAG 2 cut(s) 115, 217
Hsp92II CATG 1 cut(s) 191
Kzo9I GATC 2 cut(s) 152, 355
LpnPI CCDG 1 cut(s) 252
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 2 cut(s) 301, 378
MalI GATC 2 cut(s) 154, 357
MboI GATC 2 cut(s) 152, 355
MboII GAAGA 1 cut(s) 393
MflI RGATCY 1 cut(s) 152
MluCI AATT 3 cut(s) 207, 339, 413
MlyI GAGTC 2 cut(s) 386, 404
MmeI TCCRAC 1 cut(s) 388
MnlI CCTC 4 cut(s) 5, 85, 187, 226
MseI TTAA 2 cut(s) 440, 481
MslI CAYNNNNRTG 2 cut(s) 87, 288
Mva1269I GAATGC 1 cut(s) 269
NdeII GATC 2 cut(s) 152, 355
NlaIII CATG 1 cut(s) 191
NlaIV GGNNCC 1 cut(s) 122
NmuCI GTSAC 1 cut(s) 378
PctI GAATGC 1 cut(s) 269
PfeI GAWTC 3 cut(s) 106, 278, 366
PflMI CCANNNNNTGG 2 cut(s) 172, 262
PleI GAGTC 2 cut(s) 385, 403
PpsI GAGTC 2 cut(s) 385, 403
PspN4I GGNNCC 1 cut(s) 122
PspPI GGNCC 1 cut(s) 253
PsuI RGATCY 1 cut(s) 152
RsaI GTAC 2 cut(s) 70, 458
RsaNI GTAC 2 cut(s) 69, 457
RseI CAYNNNNRTG 2 cut(s) 87, 288
SaqAI TTAA 2 cut(s) 440, 481
Sau3AI GATC 2 cut(s) 152, 355
Sau96I GGNCC 1 cut(s) 253
ScaI AGTACT 1 cut(s) 458
SchI GAGTC 2 cut(s) 386, 404
SetI ASST 5 cut(s) 16, 96, 135, 303, 319
SfcI CTRYAG 1 cut(s) 312
SinI GGWCC 1 cut(s) 253
SmiMI CAYNNNNRTG 2 cut(s) 87, 288
SmlI CTYRAG 1 cut(s) 392
SmoI CTYRAG 1 cut(s) 392
Sse9I AATT 3 cut(s) 207, 339, 413
SspMI CTAG 1 cut(s) 156
StyI CCWWGG 1 cut(s) 345
TaaI ACNGT 1 cut(s) 452
TaqI TCGA 1 cut(s) 10
TasI AATT 3 cut(s) 207, 339, 413
TatI WGTACW 2 cut(s) 68, 456
TfiI GAWTC 3 cut(s) 106, 278, 366
Tru1I TTAA 2 cut(s) 440, 481
Tru9I TTAA 2 cut(s) 440, 481
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 378
Tsp45I GTSAC 1 cut(s) 378
TspDTI ATGAA 3 cut(s) 119, 258, 262
TspRI CASTG 1 cut(s) 187
Van91I CCANNNNNTGG 2 cut(s) 172, 262
VpaK11BI GGWCC 1 cut(s) 253
XagI CCTNNNNNAGG 1 cut(s) 9
XapI RAATTY 1 cut(s) 339
XspI CTAG 1 cut(s) 156
ZrmI AGTACT 1 cut(s) 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.