Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007642.1

Orthogroup ID

OG0004450

Physical Location & Seq

Genomic Coordinates Forward (+)

8802 .. 9467

Gene Structure 666 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007642.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 666 bp

atgaatgatcaagatgttaagtatttgattcttgctggactccctattgaatatggtcctactagaaaaattatcagaggaaaacatgatgtaaccatggatgaagtcaggtctttattgctctctgctgaatttgagattgagttacagaacaaggcattgtctttatcctctttaactactatggttgcccaaaatagtatgacattacctcacggctatacttgttcacctaccgtgtctaatgttggatatcacagtgcttactctaatgccttcttgagcaatggttgtgttctacaaaatggcaatggaaggttttctcaacccaataatggctttattcagcaaaattatggctctcagcaaaacaacggtcttcaaccaactggtattttactacatcagcctaatggattttcacagccgaatttcattacttctcaggcaaacagtggaactgtgcagcaatttaattgtcagccagattgctctatgccaaatggagttgtatataatgctactgggattggatatcataatgcatgtgctactagtgttgtgatgagtaatagaaaatatatgcatacttctagcatgaaagaaatggaaaacaagaaagagttgctttcaattgagaaagacagattggcatcagaactataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

221

Amino Acids

24.29

Weight (kDa)

6.58

Isoelectric Point (pI)

42.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004450)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G23370 AT3G23370 AT3G23370 AT3G23370
fragaria_vesca	FvH4_4g02261 FvH4_4g03920
malus_domestica	MD16G1220900.v1.1
prunus_persica	Prupe.1G041400_v2.0.a1 Prupe.1G041400_v2.0.a1
pyrus_communis	pycom16g18530
rosa_chinensis	RchiOBHm_Chr1g0364771 RchiOBHm_Chr4g0393941 RchiOBHm_Chr6g0277021
rosa_laevigata	RLG00000009724 RLG00000024329
rosa_multiflora	Rmu_co8066178.1_g000001 Rmu_sc0003401.1_g000010 Rmu_sc0007642.1_g000001 Rmu_sc0007642.1_g000002
rosa_roxburghii	Rroxscaffold_4G00325220 Rroxscaffold_5G00339020 Rroxscaffold_6G00405510 Rroxscaffold_7G00190440
rosa_rugosa	Rorug03G0370000.1 Rorug03G0370100.1 Rorug06G0419300
rosa_samantha	Rh4AG049700 Rh4BG046200 Rh4CG053300 Rh4DG046900
rosa_wichuraiana	Rw4G003940 Rw6G019670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	131, 430
AfiI	CCNNNNNNNGG	1 cut(s)	335
AgsI	TTSAA	3 cut(s)	50, 383, 633
AhlI	ACTAGT	1 cut(s)	554
AjuI	GAANNNNNNNTTGG	2 cut(s)	632, 664
ApeKI	GCWGC	1 cut(s)	466
ApoI	RAATTY	2 cut(s)	131, 430
ArsI	GACNNNNNNTTYG	2 cut(s)	361, 393
Asp700I	GAANNNNTTC	1 cut(s)	319
AspS9I	GGNCC	1 cut(s)	56
AsuHPI	GGTGA	1 cut(s)	222
AvaII	GGWCC	1 cut(s)	56
BbsI	GAAGAC	1 cut(s)	371
BbvI	GCAGC	1 cut(s)	478
BceAI	ACGGC	1 cut(s)	232
BclI	TGATCA	1 cut(s)	7
BcuI	ACTAGT	1 cut(s)	554
BfaI	CTAG	3 cut(s)	63, 555, 594
BisI	GCNGC	1 cut(s)	467
BlsI	GCNGC	1 cut(s)	468
Bme18I	GGWCC	1 cut(s)	56
BmgT120I	GGNCC	1 cut(s)	56
BmrI	ACTGGG	1 cut(s)	534
BmsI	GCATC	1 cut(s)	662
BmuI	ACTGGG	1 cut(s)	534
BpiI	GAAGAC	1 cut(s)	371
BpuEI	CTTGAG	1 cut(s)	301
BsaBI	GATNNNNATC	1 cut(s)	652
BsaJI	CCNNGG	1 cut(s)	96
Bsc4I	CCNNNNNNNGG	1 cut(s)	335
Bse1I	ACTGG	2 cut(s)	394, 529
Bse3DI	GCAATG	2 cut(s)	292, 316
Bse8I	GATNNNNATC	1 cut(s)	652
BseDI	CCNNGG	1 cut(s)	96
BseGI	GGATG	1 cut(s)	106
BseJI	GATNNNNATC	1 cut(s)	652
BseLI	CCNNNNNNNGG	1 cut(s)	335
BseMI	GCAATG	2 cut(s)	292, 316
BseMII	CTCAG	2 cut(s)	377, 458
BseNI	ACTGG	2 cut(s)	394, 529
BseXI	GCAGC	1 cut(s)	478
BsgI	GTGCAG	1 cut(s)	485
BslI	CCNNNNNNNGG	1 cut(s)	335
Bsp143I	GATC	1 cut(s)	7
Bsp19I	CCATGG	1 cut(s)	96
BspCNI	CTCAG	2 cut(s)	376, 457
BsrDI	GCAATG	2 cut(s)	292, 316
BsrI	ACTGG	2 cut(s)	394, 529
BssECI	CCNNGG	1 cut(s)	96
BssMI	GATC	1 cut(s)	7
BssT1I	CCWWGG	1 cut(s)	96
Bst4CI	ACNGT	5 cut(s)	238, 260, 377, 455, 463
BstDEI	CTNAG	2 cut(s)	363, 444
BstDSI	CCRYGG	1 cut(s)	96
BstF5I	GGATG	1 cut(s)	106
BstKTI	GATC	1 cut(s)	10
BstMBI	GATC	1 cut(s)	7
BstNSI	RCATGY	1 cut(s)	549
BstV1I	GCAGC	1 cut(s)	478
BstV2I	GAAGAC	1 cut(s)	371
BtgI	CCRYGG	1 cut(s)	96
BtsCI	GGATG	1 cut(s)	106
BtsIMutI	CAGTG	2 cut(s)	265, 460
Cfr13I	GGNCC	1 cut(s)	56
CviAII	CATG	4 cut(s)	86, 97, 546, 598
CviJI	RGCY	6 cut(s)	219, 339, 360, 409, 427, 484
CviKI_1	RGCY	6 cut(s)	219, 339, 360, 409, 427, 484
DdeI	CTNAG	2 cut(s)	363, 444
DpnI	GATC	1 cut(s)	9
DpnII	GATC	1 cut(s)	7
Eco130I	CCWWGG	1 cut(s)	96
Eco32I	GATATC	2 cut(s)	254, 536
Eco47I	GGWCC	1 cut(s)	56
EcoRV	GATATC	2 cut(s)	254, 536
EcoT14I	CCWWGG	1 cut(s)	96
EcoT22I	ATGCAT	2 cut(s)	547, 588
ErhI	CCWWGG	1 cut(s)	96
FaeI	CATG	4 cut(s)	89, 100, 549, 601
FalI	AAGNNNNNCTT	2 cut(s)	612, 644
FatI	CATG	4 cut(s)	85, 96, 545, 597
FbaI	TGATCA	1 cut(s)	7
Fnu4HI	GCNGC	1 cut(s)	467
FokI	GGATG	1 cut(s)	113
Fsp4HI	GCNGC	1 cut(s)	467
FspBI	CTAG	3 cut(s)	63, 555, 594
GluI	GCNGC	1 cut(s)	467
Hin1II	CATG	4 cut(s)	89, 100, 549, 601
HinfI	GANTC	2 cut(s)	28, 39
HphI	GGTGA	1 cut(s)	222
Hpy166II	GTNNAC	1 cut(s)	230
Hpy188I	TCNGA	2 cut(s)	77, 658
Hpy188III	TCNNGA	2 cut(s)	11, 280
Hpy8I	GTNNAC	1 cut(s)	230
HpyAV	CCTTC	2 cut(s)	286, 309
HpyCH4III	ACNGT	5 cut(s)	238, 260, 377, 455, 463
HpyCH4V	TGCA	3 cut(s)	466, 545, 586
HpyF3I	CTNAG	2 cut(s)	363, 444
Hsp92II	CATG	4 cut(s)	89, 100, 549, 601
Ksp22I	TGATCA	1 cut(s)	7
Kzo9I	GATC	1 cut(s)	7
LpnPI	CCDG	6 cut(s)	21, 94, 375, 431, 498, 510
Lsp1109I	GCAGC	1 cut(s)	478
LweI	GCATC	1 cut(s)	662
MaeI	CTAG	3 cut(s)	63, 555, 594
MaeIII	GTNAC	2 cut(s)	91, 144
MalI	GATC	1 cut(s)	9
MboI	GATC	1 cut(s)	7
MboII	GAAGA	1 cut(s)	371
MfeI	CAATTG	1 cut(s)	633
MluCI	AATT	7 cut(s)	69, 131, 352, 430, 470, 475, 633
MlyI	GAGTC	1 cut(s)	33
MmeI	TCCRAC	1 cut(s)	229
MnlI	CCTC	3 cut(s)	71, 181, 222
Mph1103I	ATGCAT	2 cut(s)	547, 588
MroXI	GAANNNNTTC	1 cut(s)	319
MseI	TTAA	3 cut(s)	18, 176, 474
MunI	CAATTG	1 cut(s)	633
NcoI	CCATGG	1 cut(s)	96
NdeII	GATC	1 cut(s)	7
NlaIII	CATG	4 cut(s)	89, 100, 549, 601
NsiI	ATGCAT	2 cut(s)	547, 588
NspI	RCATGY	1 cut(s)	549
PdmI	GAANNNNTTC	1 cut(s)	319
PfeI	GAWTC	1 cut(s)	28
PkrI	GCNGC	1 cut(s)	468
PleI	GAGTC	1 cut(s)	33
PpsI	GAGTC	1 cut(s)	33
PspPI	GGNCC	1 cut(s)	56
SaqAI	TTAA	3 cut(s)	18, 176, 474
SatI	GCNGC	1 cut(s)	467
Sau3AI	GATC	1 cut(s)	7
Sau96I	GGNCC	1 cut(s)	56
SchI	GAGTC	1 cut(s)	33
SetI	ASST	4 cut(s)	113, 214, 235, 320
SfaNI	GCATC	1 cut(s)	662
SinI	GGWCC	1 cut(s)	56
SmlI	CTYRAG	1 cut(s)	280
SmoI	CTYRAG	1 cut(s)	280
SpeI	ACTAGT	1 cut(s)	554
Sse9I	AATT	7 cut(s)	69, 131, 352, 430, 470, 475, 633
SspMI	CTAG	3 cut(s)	63, 555, 594
StyI	CCWWGG	1 cut(s)	96
TaaI	ACNGT	5 cut(s)	238, 260, 377, 455, 463
TasI	AATT	7 cut(s)	69, 131, 352, 430, 470, 475, 633
TfiI	GAWTC	1 cut(s)	28
Tru1I	TTAA	3 cut(s)	18, 176, 474
Tru9I	TTAA	3 cut(s)	18, 176, 474
TscAI	CASTG	2 cut(s)	265, 460
TseI	GCWGC	1 cut(s)	466
TspDTI	ATGAA	4 cut(s)	17, 117, 424, 614
TspRI	CASTG	2 cut(s)	265, 460
VpaK11BI	GGWCC	1 cut(s)	56
XapI	RAATTY	2 cut(s)	131, 430
XceI	RCATGY	1 cut(s)	549
XmnI	GAANNNNTTC	1 cut(s)	319
XspI	CTAG	3 cut(s)	63, 555, 594
Zsp2I	ATGCAT	2 cut(s)	547, 588

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.