Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb5

Orthogroup ID

OG0003634

Physical Location & Seq

Genomic Coordinates Forward (+)

7381124 .. 7382567

Gene Structure 1444 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_5g13090.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

ATGGACCCTTCCAAAATCTATGGAGGCCATCATGCAGAGGAAGAAGAATGCCAAAGCAGTGAATCGGGGTGGACAATGTACCTTGGGTCTTGCTTAGATGGTGAAAACAATCATCACCAACATGACAGTGATGATGATCACCATGATGGAAAAGCACAAGGCTATTGTCACAAGGATGACAGTGATGATTCCATGGTTTCTGATGCTTCTTCACGCCCAAGTACCCATCAGAGGTCCAGATCAGTTCATGCTGCAGGCAAGCAAGAAGAGAAGGCCAAGACCAAGAAGCAAAGTGCATCAGGAGCTGCAAGGATGAGAAGAGAATACAGTAAAGCATCGGAGAAGAAGGGGAAGATCATAAACTCTAAAGCTAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

126

Amino Acids

13.85

Weight (kDa)

6.54

Isoelectric Point (pI)

71.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003634)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G08150
fragaria_vesca	FvH4_4g28720 FvH4_5g13090 FvH4_5g13090
prunus_persica	Prupe.1G298800_v2.0.a1 Prupe.1G298800_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1
pyrus_communis	pycom13g04770
rosa_chinensis	RchiOBHm_Chr4g0436841 RchiOBHm_Chr7g0184051
rosa_laevigata	RLG00000005006 RLG00000006492
rosa_multiflora	Rmu_co8463551.1_g000001 Rmu_sc0004712.1_g000012 Rmu_sc0007533.1_g000014
rosa_roxburghii	Rroxscaffold_3G00269950 Rroxscaffold_5G00377910
rosa_rugosa	Rorug04G0296600 Rorug06G0461700 Rorug06G0461700
rosa_samantha	Rh4AG351000 Rh4BG360000 Rh4CG374300 Rh4DG354000 Rh7AG063400 Rh7BG063500 Rh7CG064400 Rh7DG063900
rosa_wichuraiana	Rw0G022810 Rw4G030720 Rw7G005230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	2 cut(s)	80, 223
AfiI	CCNNNNNNNGG	1 cut(s)	231
AluBI	AGCT	2 cut(s)	305, 371
AluI	AGCT	2 cut(s)	305, 371
AlwNI	CAGNNNCTG	1 cut(s)	305
AoxI	GGCC	2 cut(s)	25, 273
ApeKI	GCWGC	2 cut(s)	251, 305
AspS9I	GGNCC	2 cut(s)	4, 234
AsuHPI	GGTGA	3 cut(s)	107, 113, 131
AvaII	GGWCC	2 cut(s)	4, 234
BbvI	GCAGC	2 cut(s)	238, 292
BccI	CCATC	4 cut(s)	36, 92, 140, 234
BclI	TGATCA	1 cut(s)	136
BfmI	CTRYAG	1 cut(s)	252
BisI	GCNGC	2 cut(s)	252, 306
BlsI	GCNGC	2 cut(s)	253, 307
Bme18I	GGWCC	2 cut(s)	4, 234
BmgT120I	GGNCC	2 cut(s)	4, 234
BmiI	GGNNCC	1 cut(s)	6
BmsI	GCATC	3 cut(s)	193, 305, 344
BsaBI	GATNNNNATC	1 cut(s)	135
BsaJI	CCNNGG	2 cut(s)	82, 192
Bsc4I	CCNNNNNNNGG	1 cut(s)	231
Bse8I	GATNNNNATC	1 cut(s)	135
BseDI	CCNNGG	2 cut(s)	82, 192
BseGI	GGATG	2 cut(s)	181, 318
BseJI	GATNNNNATC	1 cut(s)	135
BseLI	CCNNNNNNNGG	1 cut(s)	231
BseXI	GCAGC	2 cut(s)	238, 292
BshFI	GGCC	2 cut(s)	27, 275
BslI	CCNNNNNNNGG	1 cut(s)	231
BsmI	GAATGC	1 cut(s)	53
BsnI	GGCC	2 cut(s)	27, 275
Bsp143I	GATC	3 cut(s)	136, 239, 354
Bsp19I	CCATGG	1 cut(s)	192
BspANI	GGCC	2 cut(s)	27, 275
BspLI	GGNNCC	1 cut(s)	6
BspMAI	CTGCAG	1 cut(s)	256
BssECI	CCNNGG	2 cut(s)	82, 192
BssMI	GATC	3 cut(s)	136, 239, 354
BssT1I	CCWWGG	2 cut(s)	82, 192
Bst4CI	ACNGT	3 cut(s)	128, 182, 329
Bst6I	CTCTTC	2 cut(s)	261, 313
BstC8I	GCNNGC	2 cut(s)	256, 260
BstDEI	CTNAG	2 cut(s)	94, 372
BstDSI	CCRYGG	1 cut(s)	192
BstF5I	GGATG	2 cut(s)	181, 318
BstKTI	GATC	3 cut(s)	139, 242, 357
BstMBI	GATC	3 cut(s)	136, 239, 354
BstMWI	GCNNNNNNNGC	1 cut(s)	302
BstSFI	CTRYAG	1 cut(s)	252
BstV1I	GCAGC	2 cut(s)	238, 292
BsuRI	GGCC	2 cut(s)	27, 275
BtgI	CCRYGG	1 cut(s)	192
BtsCI	GGATG	2 cut(s)	181, 318
BtsI	GCAGTG	1 cut(s)	64
BtsIMutI	CAGTG	3 cut(s)	64, 133, 187
Cac8I	GCNNGC	2 cut(s)	256, 260
CaiI	CAGNNNCTG	1 cut(s)	305
Cfr13I	GGNCC	2 cut(s)	4, 234
Csp6I	GTAC	2 cut(s)	79, 222
CviAII	CATG	5 cut(s)	32, 122, 143, 193, 248
CviJI	RGCY	5 cut(s)	27, 162, 275, 305, 371
CviKI_1	RGCY	5 cut(s)	27, 162, 275, 305, 371
CviQI	GTAC	2 cut(s)	79, 222
DdeI	CTNAG	2 cut(s)	94, 372
DpnI	GATC	3 cut(s)	138, 241, 356
DpnII	GATC	3 cut(s)	136, 239, 354
Eam1104I	CTCTTC	2 cut(s)	261, 313
EarI	CTCTTC	2 cut(s)	261, 313
Eco130I	CCWWGG	2 cut(s)	82, 192
Eco47I	GGWCC	2 cut(s)	4, 234
EcoT14I	CCWWGG	2 cut(s)	82, 192
ErhI	CCWWGG	2 cut(s)	82, 192
FaeI	CATG	5 cut(s)	35, 125, 146, 196, 251
FaiI	YATR	7 cut(s)	21, 33, 123, 144, 194, 249, 359
FatI	CATG	5 cut(s)	31, 121, 142, 192, 247
FbaI	TGATCA	1 cut(s)	136
Fnu4HI	GCNGC	2 cut(s)	252, 306
FokI	GGATG	2 cut(s)	188, 325
Fsp4HI	GCNGC	2 cut(s)	252, 306
GluI	GCNGC	2 cut(s)	252, 306
HaeIII	GGCC	2 cut(s)	27, 275
Hin1II	CATG	5 cut(s)	35, 125, 146, 196, 251
HinfI	GANTC	2 cut(s)	62, 188
HphI	GGTGA	3 cut(s)	107, 113, 131
Hpy166II	GTNNAC	1 cut(s)	72
Hpy188I	TCNGA	3 cut(s)	202, 231, 340
Hpy188III	TCNNGA	2 cut(s)	237, 300
Hpy8I	GTNNAC	1 cut(s)	72
HpyAV	CCTTC	3 cut(s)	18, 265, 340
HpyCH4III	ACNGT	3 cut(s)	128, 182, 329
HpyCH4V	TGCA	4 cut(s)	35, 254, 296, 308
HpyF10VI	GCNNNNNNNGC	1 cut(s)	302
HpyF3I	CTNAG	2 cut(s)	94, 372
Hsp92II	CATG	5 cut(s)	35, 125, 146, 196, 251
Ksp22I	TGATCA	1 cut(s)	136
Kzo9I	GATC	3 cut(s)	136, 239, 354
LmnI	GCTCC	1 cut(s)	302
LpnPI	CCDG	3 cut(s)	240, 250, 285
Lsp1109I	GCAGC	2 cut(s)	238, 292
LweI	GCATC	3 cut(s)	193, 305, 344
MaeIII	GTNAC	1 cut(s)	167
MalI	GATC	3 cut(s)	138, 241, 356
MboI	GATC	3 cut(s)	136, 239, 354
MboII	GAAGA	7 cut(s)	53, 56, 201, 278, 330, 355, 364
MnlI	CCTC	3 cut(s)	17, 31, 225
MslI	CAYNNNNRTG	4 cut(s)	120, 126, 144, 174
Mva1269I	GAATGC	1 cut(s)	53
MwoI	GCNNNNNNNGC	1 cut(s)	302
NcoI	CCATGG	1 cut(s)	192
NdeII	GATC	3 cut(s)	136, 239, 354
NlaIII	CATG	5 cut(s)	35, 125, 146, 196, 251
NlaIV	GGNNCC	1 cut(s)	6
NmuCI	GTSAC	1 cut(s)	167
PctI	GAATGC	1 cut(s)	53
PfeI	GAWTC	2 cut(s)	62, 188
PkrI	GCNGC	2 cut(s)	253, 307
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	2 cut(s)	4, 234
PstI	CTGCAG	1 cut(s)	256
PstNI	CAGNNNCTG	1 cut(s)	305
RsaI	GTAC	2 cut(s)	80, 223
RsaNI	GTAC	2 cut(s)	79, 222
RseI	CAYNNNNRTG	4 cut(s)	120, 126, 144, 174
SatI	GCNGC	2 cut(s)	252, 306
Sau3AI	GATC	3 cut(s)	136, 239, 354
Sau96I	GGNCC	2 cut(s)	4, 234
SetI	ASST	4 cut(s)	84, 236, 307, 373
SfaNI	GCATC	3 cut(s)	193, 305, 344
SfcI	CTRYAG	1 cut(s)	252
SinI	GGWCC	2 cut(s)	4, 234
SmiMI	CAYNNNNRTG	4 cut(s)	120, 126, 144, 174
StyI	CCWWGG	2 cut(s)	82, 192
TaaI	ACNGT	3 cut(s)	128, 182, 329
TfiI	GAWTC	2 cut(s)	62, 188
TscAI	CASTG	3 cut(s)	64, 133, 187
TseFI	GTSAC	1 cut(s)	167
TseI	GCWGC	2 cut(s)	251, 305
Tsp45I	GTSAC	1 cut(s)	167
TspDTI	ATGAA	1 cut(s)	236
TspRI	CASTG	3 cut(s)	64, 133, 187
VpaK11BI	GGWCC	2 cut(s)	4, 234

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.