Rmu_sc0004712.1_g000012

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004712.1
Physical Location & Seq
Forward (+)
57133 .. 57513
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004712.1_g000012.1.cds

Sequence Viewer

Length: 381 bp
atggacccttccaaaatctatggaggccatcacgcagaggaagaatgtcaaagcagtgaatcagggtggacagcgtatcttgggtctcgcatagatggcgaaaacgatcatcaccaacatgatcaagatcacagtgatgatgatcgccatgatggaaaaacacatggctatgatcacaaggatgacagtgatgattccatggtttctgatgcttcttctggcccaagtacccatcagaggtccagatcagttcatgtcggcaagcaagaagagaaggccaagaccaagaagcaaagtgcatcaggagctgcaaggatgagaagggactacagtaaagcagccgagaagaaggggaagatcataaactctaaagctaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

13.99

Weight (kDa)

6.4

Isoelectric Point (pI)

57.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 229
AfiI CCNNNNNNNGG 1 cut(s) 237
AluBI AGCT 2 cut(s) 308, 374
AluI AGCT 2 cut(s) 308, 374
Alw26I GTCTC 1 cut(s) 90
AlwNI CAGNNNCTG 1 cut(s) 308
AoxI GGCC 3 cut(s) 25, 220, 276
ApeKI GCWGC 2 cut(s) 308, 338
AspS9I GGNCC 3 cut(s) 4, 221, 240
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 2 cut(s) 4, 240
BbvI GCAGC 2 cut(s) 295, 350
BccI CCATC 4 cut(s) 36, 89, 146, 240
BclI TGATCA 2 cut(s) 121, 172
BcoDI GTCTC 1 cut(s) 90
BfmI CTRYAG 1 cut(s) 328
BisI GCNGC 2 cut(s) 309, 339
BlsI GCNGC 2 cut(s) 310, 340
Bme18I GGWCC 2 cut(s) 4, 240
BmgT120I GGNCC 3 cut(s) 4, 221, 240
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 199, 308
BsaBI GATNNNNATC 2 cut(s) 126, 141
BsaI GGTCTC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 198
Bsc4I CCNNNNNNNGG 1 cut(s) 237
Bse8I GATNNNNATC 2 cut(s) 126, 141
BseDI CCNNGG 1 cut(s) 198
BseGI GGATG 2 cut(s) 187, 321
BseJI GATNNNNATC 2 cut(s) 126, 141
BseLI CCNNNNNNNGG 1 cut(s) 237
BseXI GCAGC 2 cut(s) 295, 350
BshFI GGCC 3 cut(s) 27, 222, 278
BslFI GGGAC 1 cut(s) 338
BslI CCNNNNNNNGG 1 cut(s) 237
BsmAI GTCTC 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 338
BsnI GGCC 3 cut(s) 27, 222, 278
Bso31I GGTCTC 1 cut(s) 90
Bsp143I GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
Bsp19I CCATGG 1 cut(s) 198
BspANI GGCC 3 cut(s) 27, 222, 278
BspLI GGNNCC 1 cut(s) 6
BspTNI GGTCTC 1 cut(s) 90
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
BssT1I CCWWGG 1 cut(s) 198
Bst4CI ACNGT 3 cut(s) 134, 188, 332
Bst6I CTCTTC 1 cut(s) 264
BstC8I GCNNGC 1 cut(s) 263
BstDEI CTNAG 1 cut(s) 375
BstDSI CCRYGG 1 cut(s) 198
BstF5I GGATG 2 cut(s) 187, 321
BstKTI GATC 7 cut(s) 109, 124, 130, 145, 175, 248, 360
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
BstMWI GCNNNNNNNGC 2 cut(s) 96, 305
BstSFI CTRYAG 1 cut(s) 328
BstV1I GCAGC 2 cut(s) 295, 350
BsuRI GGCC 3 cut(s) 27, 222, 278
BtgI CCRYGG 1 cut(s) 198
BtsCI GGATG 2 cut(s) 187, 321
BtsI GCAGTG 1 cut(s) 61
BtsIMutI CAGTG 3 cut(s) 61, 139, 193
Cac8I GCNNGC 1 cut(s) 263
CaiI CAGNNNCTG 1 cut(s) 308
Cfr13I GGNCC 3 cut(s) 4, 221, 240
Csp6I GTAC 1 cut(s) 228
CviAII CATG 5 cut(s) 119, 149, 164, 199, 254
CviJI RGCY 7 cut(s) 27, 168, 222, 278, 308, 341, 374
CviKI_1 RGCY 7 cut(s) 27, 168, 222, 278, 308, 341, 374
CviQI GTAC 1 cut(s) 228
DdeI CTNAG 1 cut(s) 375
DpnI GATC 7 cut(s) 108, 123, 129, 144, 174, 247, 359
DpnII GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
Eam1104I CTCTTC 1 cut(s) 264
EarI CTCTTC 1 cut(s) 264
Eco130I CCWWGG 1 cut(s) 198
Eco31I GGTCTC 1 cut(s) 90
Eco47I GGWCC 2 cut(s) 4, 240
EcoT14I CCWWGG 1 cut(s) 198
ErhI CCWWGG 1 cut(s) 198
FaeI CATG 5 cut(s) 122, 152, 167, 202, 257
FaiI YATR 9 cut(s) 21, 92, 120, 150, 165, 171, 200, 255, 362
FaqI GGGAC 1 cut(s) 338
FatI CATG 5 cut(s) 118, 148, 163, 198, 253
FbaI TGATCA 2 cut(s) 121, 172
Fnu4HI GCNGC 2 cut(s) 309, 339
FokI GGATG 2 cut(s) 194, 328
Fsp4HI GCNGC 2 cut(s) 309, 339
GluI GCNGC 2 cut(s) 309, 339
HaeIII GGCC 3 cut(s) 27, 222, 278
Hin1II CATG 5 cut(s) 122, 152, 167, 202, 257
HinfI GANTC 2 cut(s) 59, 194
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 69
Hpy188I TCNGA 2 cut(s) 208, 237
Hpy188III TCNNGA 3 cut(s) 125, 243, 303
Hpy8I GTNNAC 1 cut(s) 69
HpyAV CCTTC 4 cut(s) 18, 268, 315, 343
HpyCH4III ACNGT 3 cut(s) 134, 188, 332
HpyCH4V TGCA 2 cut(s) 299, 311
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 305
HpyF3I CTNAG 1 cut(s) 375
Hsp92II CATG 5 cut(s) 122, 152, 167, 202, 257
Ksp22I TGATCA 2 cut(s) 121, 172
Kzo9I GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
LmnI GCTCC 1 cut(s) 305
LpnPI CCDG 4 cut(s) 48, 204, 256, 288
Lsp1109I GCAGC 2 cut(s) 295, 350
LweI GCATC 2 cut(s) 199, 308
MalI GATC 7 cut(s) 108, 123, 129, 144, 174, 247, 359
MboI GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
MboII GAAGA 5 cut(s) 53, 207, 281, 358, 367
MnlI CCTC 3 cut(s) 17, 31, 231
MslI CAYNNNNRTG 4 cut(s) 117, 135, 168, 180
MwoI GCNNNNNNNGC 2 cut(s) 96, 305
NcoI CCATGG 1 cut(s) 198
NdeII GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
NlaIII CATG 5 cut(s) 122, 152, 167, 202, 257
NlaIV GGNNCC 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 367
PfeI GAWTC 2 cut(s) 59, 194
PkrI GCNGC 2 cut(s) 310, 340
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 3 cut(s) 4, 221, 240
PstNI CAGNNNCTG 1 cut(s) 308
RsaI GTAC 1 cut(s) 229
RsaNI GTAC 1 cut(s) 228
RseI CAYNNNNRTG 4 cut(s) 117, 135, 168, 180
SatI GCNGC 2 cut(s) 309, 339
Sau3AI GATC 7 cut(s) 106, 121, 127, 142, 172, 245, 357
Sau96I GGNCC 3 cut(s) 4, 221, 240
SetI ASST 3 cut(s) 242, 310, 376
SfaNI GCATC 2 cut(s) 199, 308
SfcI CTRYAG 1 cut(s) 328
SinI GGWCC 2 cut(s) 4, 240
SmiMI CAYNNNNRTG 4 cut(s) 117, 135, 168, 180
StyI CCWWGG 1 cut(s) 198
TaaI ACNGT 3 cut(s) 134, 188, 332
TfiI GAWTC 2 cut(s) 59, 194
TscAI CASTG 3 cut(s) 61, 139, 193
TseI GCWGC 2 cut(s) 308, 338
TspDTI ATGAA 1 cut(s) 242
TspRI CASTG 3 cut(s) 61, 139, 193
VpaK11BI GGWCC 2 cut(s) 4, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.