Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007533.1

Orthogroup ID

OG0003634

Physical Location & Seq

Genomic Coordinates Reverse (-)

35310 .. 35690

Gene Structure 381 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007533.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atggacccttccaaaatctatggaggccatcatgcagaggaagaatgtcaaagcagtgaatcagggtggacaacgtatcttgggtctcgcatagatggcgaaaacgatcatcaccaacatgatcaagatcacagtgatgatgatcgccatgatggaaaaacacatggctatgatcacaaggatgacagtgatgattccatggtttctgatgcttcttctggcccaagtacccatcagaggtccagatcagttcatgtcggcaagcaagaagagaaggccaagaccaagaagcaaagtgcatcaggagctgcaaggatgagaagggacttcagtaaagcagccgagaagaaggggaagatcataaactcgaaagctaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

126

Amino Acids

14.0

Weight (kDa)

6.4

Isoelectric Point (pI)

57.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003634)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G08150
fragaria_vesca	FvH4_4g28720 FvH4_5g13090 FvH4_5g13090
prunus_persica	Prupe.1G298800_v2.0.a1 Prupe.1G298800_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1
pyrus_communis	pycom13g04770
rosa_chinensis	RchiOBHm_Chr4g0436841 RchiOBHm_Chr7g0184051
rosa_laevigata	RLG00000005006 RLG00000006492
rosa_multiflora	Rmu_co8463551.1_g000001 Rmu_sc0004712.1_g000012 Rmu_sc0007533.1_g000014
rosa_roxburghii	Rroxscaffold_3G00269950 Rroxscaffold_5G00377910
rosa_rugosa	Rorug04G0296600 Rorug06G0461700 Rorug06G0461700
rosa_samantha	Rh4AG351000 Rh4BG360000 Rh4CG374300 Rh4DG354000 Rh7AG063400 Rh7BG063500 Rh7CG064400 Rh7DG063900
rosa_wichuraiana	Rw0G022810 Rw4G030720 Rw7G005230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	313
AfaI	GTAC	1 cut(s)	229
AfiI	CCNNNNNNNGG	1 cut(s)	237
AluBI	AGCT	2 cut(s)	308, 374
AluI	AGCT	2 cut(s)	308, 374
Alw26I	GTCTC	1 cut(s)	90
AlwNI	CAGNNNCTG	1 cut(s)	308
AoxI	GGCC	3 cut(s)	25, 220, 276
ApeKI	GCWGC	2 cut(s)	308, 338
AspS9I	GGNCC	3 cut(s)	4, 221, 240
AsuHPI	GGTGA	1 cut(s)	104
AvaII	GGWCC	2 cut(s)	4, 240
BbvI	GCAGC	2 cut(s)	295, 350
BccI	CCATC	4 cut(s)	36, 89, 146, 240
BclI	TGATCA	2 cut(s)	121, 172
BcoDI	GTCTC	1 cut(s)	90
BisI	GCNGC	2 cut(s)	309, 339
BlsI	GCNGC	2 cut(s)	310, 340
Bme18I	GGWCC	2 cut(s)	4, 240
BmgT120I	GGNCC	3 cut(s)	4, 221, 240
BmiI	GGNNCC	1 cut(s)	6
BmsI	GCATC	2 cut(s)	199, 308
BsaBI	GATNNNNATC	2 cut(s)	126, 141
BsaI	GGTCTC	1 cut(s)	90
BsaJI	CCNNGG	1 cut(s)	198
Bsc4I	CCNNNNNNNGG	1 cut(s)	237
Bse8I	GATNNNNATC	2 cut(s)	126, 141
BseDI	CCNNGG	1 cut(s)	198
BseGI	GGATG	2 cut(s)	187, 321
BseJI	GATNNNNATC	2 cut(s)	126, 141
BseLI	CCNNNNNNNGG	1 cut(s)	237
BseXI	GCAGC	2 cut(s)	295, 350
BshFI	GGCC	3 cut(s)	27, 222, 278
BslFI	GGGAC	1 cut(s)	338
BslI	CCNNNNNNNGG	1 cut(s)	237
BsmAI	GTCTC	1 cut(s)	90
BsmFI	GGGAC	1 cut(s)	338
BsnI	GGCC	3 cut(s)	27, 222, 278
Bso31I	GGTCTC	1 cut(s)	90
Bsp143I	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
Bsp19I	CCATGG	1 cut(s)	198
BspANI	GGCC	3 cut(s)	27, 222, 278
BspLI	GGNNCC	1 cut(s)	6
BspTNI	GGTCTC	1 cut(s)	90
BssECI	CCNNGG	1 cut(s)	198
BssMI	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
BssT1I	CCWWGG	1 cut(s)	198
Bst4CI	ACNGT	2 cut(s)	134, 188
Bst6I	CTCTTC	1 cut(s)	264
BstC8I	GCNNGC	1 cut(s)	263
BstDEI	CTNAG	1 cut(s)	375
BstDSI	CCRYGG	1 cut(s)	198
BstF5I	GGATG	2 cut(s)	187, 321
BstKTI	GATC	7 cut(s)	109, 124, 130, 145, 175, 248, 360
BstMAI	GTCTC	1 cut(s)	90
BstMBI	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
BstMWI	GCNNNNNNNGC	2 cut(s)	96, 305
BstV1I	GCAGC	2 cut(s)	295, 350
BsuRI	GGCC	3 cut(s)	27, 222, 278
BtgI	CCRYGG	1 cut(s)	198
BtsCI	GGATG	2 cut(s)	187, 321
BtsI	GCAGTG	1 cut(s)	61
BtsIMutI	CAGTG	3 cut(s)	61, 139, 193
Cac8I	GCNNGC	1 cut(s)	263
CaiI	CAGNNNCTG	1 cut(s)	308
Cfr13I	GGNCC	3 cut(s)	4, 221, 240
Csp6I	GTAC	1 cut(s)	228
CviAII	CATG	6 cut(s)	32, 119, 149, 164, 199, 254
CviJI	RGCY	7 cut(s)	27, 168, 222, 278, 308, 341, 374
CviKI_1	RGCY	7 cut(s)	27, 168, 222, 278, 308, 341, 374
CviQI	GTAC	1 cut(s)	228
DdeI	CTNAG	1 cut(s)	375
DpnI	GATC	7 cut(s)	108, 123, 129, 144, 174, 247, 359
DpnII	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
Eam1104I	CTCTTC	1 cut(s)	264
EarI	CTCTTC	1 cut(s)	264
Eco130I	CCWWGG	1 cut(s)	198
Eco31I	GGTCTC	1 cut(s)	90
Eco47I	GGWCC	2 cut(s)	4, 240
Eco57I	CTGAAG	1 cut(s)	313
EcoT14I	CCWWGG	1 cut(s)	198
ErhI	CCWWGG	1 cut(s)	198
FaeI	CATG	6 cut(s)	35, 122, 152, 167, 202, 257
FaqI	GGGAC	1 cut(s)	338
FatI	CATG	6 cut(s)	31, 118, 148, 163, 198, 253
FbaI	TGATCA	2 cut(s)	121, 172
Fnu4HI	GCNGC	2 cut(s)	309, 339
FokI	GGATG	2 cut(s)	194, 328
Fsp4HI	GCNGC	2 cut(s)	309, 339
GluI	GCNGC	2 cut(s)	309, 339
HaeIII	GGCC	3 cut(s)	27, 222, 278
Hin1II	CATG	6 cut(s)	35, 122, 152, 167, 202, 257
HinfI	GANTC	2 cut(s)	59, 194
HphI	GGTGA	1 cut(s)	104
Hpy166II	GTNNAC	1 cut(s)	69
Hpy188I	TCNGA	2 cut(s)	208, 237
Hpy188III	TCNNGA	3 cut(s)	125, 243, 303
Hpy8I	GTNNAC	1 cut(s)	69
HpyAV	CCTTC	4 cut(s)	18, 268, 315, 343
HpyCH4III	ACNGT	2 cut(s)	134, 188
HpyCH4IV	ACGT	1 cut(s)	74
HpyCH4V	TGCA	3 cut(s)	35, 299, 311
HpyF10VI	GCNNNNNNNGC	2 cut(s)	96, 305
HpyF3I	CTNAG	1 cut(s)	375
HpySE526I	ACGT	1 cut(s)	74
Hsp92II	CATG	6 cut(s)	35, 122, 152, 167, 202, 257
Ksp22I	TGATCA	2 cut(s)	121, 172
Kzo9I	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
LmnI	GCTCC	1 cut(s)	305
LpnPI	CCDG	4 cut(s)	48, 204, 256, 288
Lsp1109I	GCAGC	2 cut(s)	295, 350
LweI	GCATC	2 cut(s)	199, 308
MaeII	ACGT	1 cut(s)	74
MalI	GATC	7 cut(s)	108, 123, 129, 144, 174, 247, 359
MboI	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
MboII	GAAGA	5 cut(s)	53, 207, 281, 358, 367
MnlI	CCTC	3 cut(s)	17, 31, 231
MslI	CAYNNNNRTG	4 cut(s)	117, 135, 168, 180
MwoI	GCNNNNNNNGC	2 cut(s)	96, 305
NcoI	CCATGG	1 cut(s)	198
NdeII	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
NlaIII	CATG	6 cut(s)	35, 122, 152, 167, 202, 257
NlaIV	GGNNCC	1 cut(s)	6
NmeAIII	GCCGAG	1 cut(s)	367
PfeI	GAWTC	2 cut(s)	59, 194
PkrI	GCNGC	2 cut(s)	310, 340
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	3 cut(s)	4, 221, 240
PstNI	CAGNNNCTG	1 cut(s)	308
RsaI	GTAC	1 cut(s)	229
RsaNI	GTAC	1 cut(s)	228
RseI	CAYNNNNRTG	4 cut(s)	117, 135, 168, 180
SatI	GCNGC	2 cut(s)	309, 339
Sau3AI	GATC	7 cut(s)	106, 121, 127, 142, 172, 245, 357
Sau96I	GGNCC	3 cut(s)	4, 221, 240
SetI	ASST	4 cut(s)	77, 242, 310, 376
SfaNI	GCATC	2 cut(s)	199, 308
SinI	GGWCC	2 cut(s)	4, 240
SmiMI	CAYNNNNRTG	4 cut(s)	117, 135, 168, 180
StyI	CCWWGG	1 cut(s)	198
TaaI	ACNGT	2 cut(s)	134, 188
TaiI	ACGT	1 cut(s)	77
TaqI	TCGA	1 cut(s)	368
TfiI	GAWTC	2 cut(s)	59, 194
TscAI	CASTG	3 cut(s)	61, 139, 193
TseI	GCWGC	2 cut(s)	308, 338
TspDTI	ATGAA	1 cut(s)	242
TspRI	CASTG	3 cut(s)	61, 139, 193
VpaK11BI	GGWCC	2 cut(s)	4, 240

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.