Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0003634

Physical Location & Seq

Genomic Coordinates Forward (+)

62664449 .. 62665065

Gene Structure 617 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00269950.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 393 bp

ATGTTTTTCTTTATGGACCCTTCCAAAATCTATGGAGGCCATCATGCAGAGGAAGAATGTCAAAGCAGTGAATCAGGGTGGACAACGTATCTTGGGTCTCGCATAGATGGCGAAAACGATCATCACCAACATGATCAAGATCACAGTGATGATGATCGTCATGATGGAAAAACACATGGCTATGATCACAAGGATGACAGTGATGATTCCATGGTTTCTGATGCTTCTTCTGGCCCAAGTACCCATCAGAGGTCCAGATCAGTTCATGTCGGCAAGCAAGAAGAGAAGGCCAAGACCAAGAAGCAAAGTGCATCAGGAGCTGCAAGGATGAGAAGGAACTACAGTAAAGCAGCCGAGAAGAAGGGGAAGATCATAAACTCTAAAGCTAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

130

Amino Acids

14.59

Weight (kDa)

6.59

Isoelectric Point (pI)

57.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003634)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G08150
fragaria_vesca	FvH4_4g28720 FvH4_5g13090 FvH4_5g13090
prunus_persica	Prupe.1G298800_v2.0.a1 Prupe.1G298800_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1 Prupe.5G211600_v2.0.a1
pyrus_communis	pycom13g04770
rosa_chinensis	RchiOBHm_Chr4g0436841 RchiOBHm_Chr7g0184051
rosa_laevigata	RLG00000005006 RLG00000006492
rosa_multiflora	Rmu_co8463551.1_g000001 Rmu_sc0004712.1_g000012 Rmu_sc0007533.1_g000014
rosa_roxburghii	Rroxscaffold_3G00269950 Rroxscaffold_5G00377910
rosa_rugosa	Rorug04G0296600 Rorug06G0461700 Rorug06G0461700
rosa_samantha	Rh4AG351000 Rh4BG360000 Rh4CG374300 Rh4DG354000 Rh7AG063400 Rh7BG063500 Rh7CG064400 Rh7DG063900
rosa_wichuraiana	Rw0G022810 Rw4G030720 Rw7G005230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	241
AfiI	CCNNNNNNNGG	1 cut(s)	249
AluBI	AGCT	2 cut(s)	320, 386
AluI	AGCT	2 cut(s)	320, 386
Alw26I	GTCTC	1 cut(s)	102
AlwNI	CAGNNNCTG	1 cut(s)	320
AoxI	GGCC	3 cut(s)	37, 232, 288
ApeKI	GCWGC	2 cut(s)	320, 350
AspS9I	GGNCC	3 cut(s)	16, 233, 252
AsuHPI	GGTGA	1 cut(s)	116
AvaII	GGWCC	2 cut(s)	16, 252
BbvI	GCAGC	2 cut(s)	307, 362
BccI	CCATC	4 cut(s)	48, 101, 158, 252
BclI	TGATCA	2 cut(s)	133, 184
BcoDI	GTCTC	1 cut(s)	102
BfmI	CTRYAG	1 cut(s)	340
BisI	GCNGC	2 cut(s)	321, 351
BlsI	GCNGC	2 cut(s)	322, 352
Bme18I	GGWCC	2 cut(s)	16, 252
BmgT120I	GGNCC	3 cut(s)	16, 233, 252
BmiI	GGNNCC	1 cut(s)	18
BmsI	GCATC	2 cut(s)	211, 320
BsaBI	GATNNNNATC	2 cut(s)	138, 153
BsaI	GGTCTC	1 cut(s)	102
BsaJI	CCNNGG	1 cut(s)	210
Bsc4I	CCNNNNNNNGG	1 cut(s)	249
Bse8I	GATNNNNATC	2 cut(s)	138, 153
BseDI	CCNNGG	1 cut(s)	210
BseGI	GGATG	2 cut(s)	199, 333
BseJI	GATNNNNATC	2 cut(s)	138, 153
BseLI	CCNNNNNNNGG	1 cut(s)	249
BseXI	GCAGC	2 cut(s)	307, 362
BshFI	GGCC	3 cut(s)	39, 234, 290
BslI	CCNNNNNNNGG	1 cut(s)	249
BsmAI	GTCTC	1 cut(s)	102
BsnI	GGCC	3 cut(s)	39, 234, 290
Bso31I	GGTCTC	1 cut(s)	102
Bsp143I	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
Bsp19I	CCATGG	1 cut(s)	210
BspANI	GGCC	3 cut(s)	39, 234, 290
BspHI	TCATGA	1 cut(s)	160
BspLI	GGNNCC	1 cut(s)	18
BspTNI	GGTCTC	1 cut(s)	102
BssECI	CCNNGG	1 cut(s)	210
BssMI	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
BssT1I	CCWWGG	1 cut(s)	210
Bst4CI	ACNGT	3 cut(s)	146, 200, 344
Bst6I	CTCTTC	1 cut(s)	276
BstC8I	GCNNGC	1 cut(s)	275
BstDEI	CTNAG	1 cut(s)	387
BstDSI	CCRYGG	1 cut(s)	210
BstF5I	GGATG	2 cut(s)	199, 333
BstKTI	GATC	7 cut(s)	121, 136, 142, 157, 187, 260, 372
BstMAI	GTCTC	1 cut(s)	102
BstMBI	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
BstMWI	GCNNNNNNNGC	2 cut(s)	108, 317
BstSFI	CTRYAG	1 cut(s)	340
BstV1I	GCAGC	2 cut(s)	307, 362
BsuRI	GGCC	3 cut(s)	39, 234, 290
BtgI	CCRYGG	1 cut(s)	210
BtsCI	GGATG	2 cut(s)	199, 333
BtsI	GCAGTG	1 cut(s)	73
BtsIMutI	CAGTG	3 cut(s)	73, 151, 205
Cac8I	GCNNGC	1 cut(s)	275
CaiI	CAGNNNCTG	1 cut(s)	320
CciI	TCATGA	1 cut(s)	160
Cfr13I	GGNCC	3 cut(s)	16, 233, 252
Csp6I	GTAC	1 cut(s)	240
CviAII	CATG	6 cut(s)	44, 131, 161, 176, 211, 266
CviJI	RGCY	7 cut(s)	39, 180, 234, 290, 320, 353, 386
CviKI_1	RGCY	7 cut(s)	39, 180, 234, 290, 320, 353, 386
CviQI	GTAC	1 cut(s)	240
DdeI	CTNAG	1 cut(s)	387
DpnI	GATC	7 cut(s)	120, 135, 141, 156, 186, 259, 371
DpnII	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
Eam1104I	CTCTTC	1 cut(s)	276
EarI	CTCTTC	1 cut(s)	276
Eco130I	CCWWGG	1 cut(s)	210
Eco31I	GGTCTC	1 cut(s)	102
Eco47I	GGWCC	2 cut(s)	16, 252
EcoT14I	CCWWGG	1 cut(s)	210
ErhI	CCWWGG	1 cut(s)	210
FaeI	CATG	6 cut(s)	47, 134, 164, 179, 214, 269
FatI	CATG	6 cut(s)	43, 130, 160, 175, 210, 265
FbaI	TGATCA	2 cut(s)	133, 184
Fnu4HI	GCNGC	2 cut(s)	321, 351
FokI	GGATG	2 cut(s)	206, 340
Fsp4HI	GCNGC	2 cut(s)	321, 351
GluI	GCNGC	2 cut(s)	321, 351
HaeIII	GGCC	3 cut(s)	39, 234, 290
Hin1II	CATG	6 cut(s)	47, 134, 164, 179, 214, 269
HinfI	GANTC	2 cut(s)	71, 206
HphI	GGTGA	1 cut(s)	116
Hpy166II	GTNNAC	1 cut(s)	81
Hpy188I	TCNGA	2 cut(s)	220, 249
Hpy188III	TCNNGA	4 cut(s)	137, 161, 255, 315
Hpy8I	GTNNAC	1 cut(s)	81
HpyAV	CCTTC	4 cut(s)	30, 280, 327, 355
HpyCH4III	ACNGT	3 cut(s)	146, 200, 344
HpyCH4IV	ACGT	1 cut(s)	86
HpyCH4V	TGCA	3 cut(s)	47, 311, 323
HpyF10VI	GCNNNNNNNGC	2 cut(s)	108, 317
HpyF3I	CTNAG	1 cut(s)	387
HpySE526I	ACGT	1 cut(s)	86
Hsp92II	CATG	6 cut(s)	47, 134, 164, 179, 214, 269
Ksp22I	TGATCA	2 cut(s)	133, 184
Kzo9I	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
LmnI	GCTCC	1 cut(s)	317
LpnPI	CCDG	4 cut(s)	60, 216, 268, 300
Lsp1109I	GCAGC	2 cut(s)	307, 362
LweI	GCATC	2 cut(s)	211, 320
MaeII	ACGT	1 cut(s)	86
MalI	GATC	7 cut(s)	120, 135, 141, 156, 186, 259, 371
MboI	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
MboII	GAAGA	5 cut(s)	65, 219, 293, 370, 379
MnlI	CCTC	3 cut(s)	29, 43, 243
MslI	CAYNNNNRTG	4 cut(s)	129, 147, 180, 192
MwoI	GCNNNNNNNGC	2 cut(s)	108, 317
NcoI	CCATGG	1 cut(s)	210
NdeII	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
NlaIII	CATG	6 cut(s)	47, 134, 164, 179, 214, 269
NlaIV	GGNNCC	1 cut(s)	18
NmeAIII	GCCGAG	1 cut(s)	379
PagI	TCATGA	1 cut(s)	160
PfeI	GAWTC	2 cut(s)	71, 206
PkrI	GCNGC	2 cut(s)	322, 352
PspN4I	GGNNCC	1 cut(s)	18
PspPI	GGNCC	3 cut(s)	16, 233, 252
PstNI	CAGNNNCTG	1 cut(s)	320
RsaI	GTAC	1 cut(s)	241
RsaNI	GTAC	1 cut(s)	240
RseI	CAYNNNNRTG	4 cut(s)	129, 147, 180, 192
SatI	GCNGC	2 cut(s)	321, 351
Sau3AI	GATC	7 cut(s)	118, 133, 139, 154, 184, 257, 369
Sau96I	GGNCC	3 cut(s)	16, 233, 252
SetI	ASST	4 cut(s)	89, 254, 322, 388
SfaNI	GCATC	2 cut(s)	211, 320
SfcI	CTRYAG	1 cut(s)	340
SinI	GGWCC	2 cut(s)	16, 252
SmiMI	CAYNNNNRTG	4 cut(s)	129, 147, 180, 192
StyI	CCWWGG	1 cut(s)	210
TaaI	ACNGT	3 cut(s)	146, 200, 344
TaiI	ACGT	1 cut(s)	89
TfiI	GAWTC	2 cut(s)	71, 206
TscAI	CASTG	3 cut(s)	73, 151, 205
TseI	GCWGC	2 cut(s)	320, 350
TspDTI	ATGAA	1 cut(s)	254
TspRI	CASTG	3 cut(s)	73, 151, 205
VpaK11BI	GGWCC	2 cut(s)	16, 252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.