FvH4_5g25690

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
17196142 .. 17196611
470 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g25690.t1

Sequence Viewer

Length: 207 bp
ATGATTATGCCTGAGCTTTATCAGAATGAACATGTCCAGAAGATGATTCAAGACAAATGGATTAAGAAACTAGGAGCAGAGCAACTTAAGCTCTGCCTGAAGAAGAATGGGTTCAAACTGATTGGCAATGTGGACACAGTAATTCAGCATATTAAGGACCATCTAGACAAAGAGTCTCTGATATACAACCACTTACCAGACCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.05

Weight (kDa)

7.89

Isoelectric Point (pI)

19.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 119
AflII CTTAAG 1 cut(s) 86
AflIII ACRYGT 1 cut(s) 31
AgsI TTSAA 2 cut(s) 50, 115
AhdI GACNNNNNGTC 1 cut(s) 172
AluBI AGCT 2 cut(s) 16, 91
AluI AGCT 2 cut(s) 16, 91
Alw26I GTCTC 1 cut(s) 180
Asp700I GAANNNNTTC 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 157
AvaII GGWCC 1 cut(s) 157
BccI CCATC 1 cut(s) 168
BcoDI GTCTC 1 cut(s) 180
BfaI CTAG 2 cut(s) 71, 164
BfrI CTTAAG 1 cut(s) 86
Bme18I GGWCC 1 cut(s) 157
BmeRI GACNNNNNGTC 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 157
Bpu10I CCTNAGC 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 202
Bse3DI GCAATG 1 cut(s) 133
BseMI GCAATG 1 cut(s) 133
BseNI ACTGG 1 cut(s) 202
BsmAI GTCTC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 4
BspTI CTTAAG 1 cut(s) 86
BsrDI GCAATG 1 cut(s) 133
BsrI ACTGG 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 139
BstAFI CTTAAG 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 12
BstMAI GTCTC 1 cut(s) 180
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstNSI RCATGY 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 157
CviAII CATG 1 cut(s) 32
CviJI RGCY 2 cut(s) 16, 91
CviKI_1 RGCY 2 cut(s) 16, 91
DdeI CTNAG 1 cut(s) 12
DriI GACNNNNNGTC 1 cut(s) 172
Eam1105I GACNNNNNGTC 1 cut(s) 172
Eco47I GGWCC 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 119
FaeI CATG 1 cut(s) 35
FaiI YATR 4 cut(s) 8, 33, 150, 184
FatI CATG 1 cut(s) 31
FspBI CTAG 2 cut(s) 71, 164
Hin1II CATG 1 cut(s) 35
HinfI GANTC 2 cut(s) 46, 173
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 2 cut(s) 24, 180
Hpy188III TCNNGA 3 cut(s) 37, 50, 164
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4III ACNGT 1 cut(s) 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 1 cut(s) 35
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 3 cut(s) 24, 50, 110
MaeI CTAG 2 cut(s) 71, 164
MboII GAAGA 3 cut(s) 52, 112, 115
MluCI AATT 1 cut(s) 141
MlyI GAGTC 1 cut(s) 182
MroXI GAANNNNTTC 1 cut(s) 110
MseI TTAA 3 cut(s) 63, 87, 153
MspCI CTTAAG 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 88
NlaIII CATG 1 cut(s) 35
NspI RCATGY 1 cut(s) 35
PciI ACATGT 1 cut(s) 31
PdmI GAANNNNTTC 1 cut(s) 110
PfeI GAWTC 1 cut(s) 46
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
PscI ACATGT 1 cut(s) 31
PspPI GGNCC 1 cut(s) 157
SaqAI TTAA 3 cut(s) 63, 87, 153
Sau96I GGNCC 1 cut(s) 157
SchI GAGTC 1 cut(s) 182
SetI ASST 2 cut(s) 18, 93
SgeI CNNG 7 cut(s) 23, 44, 49, 62, 83, 109, 176
SinI GGWCC 1 cut(s) 157
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 1 cut(s) 141
SspMI CTAG 2 cut(s) 71, 164
TaaI ACNGT 1 cut(s) 139
TasI AATT 1 cut(s) 141
TfiI GAWTC 1 cut(s) 46
Tru1I TTAA 3 cut(s) 63, 87, 153
Tru9I TTAA 3 cut(s) 63, 87, 153
TspDTI ATGAA 1 cut(s) 42
Vha464I CTTAAG 1 cut(s) 86
VpaK11BI GGWCC 1 cut(s) 157
XbaI TCTAGA 1 cut(s) 163
XceI RCATGY 1 cut(s) 35
XmnI GAANNNNTTC 1 cut(s) 110
XspI CTAG 2 cut(s) 71, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.