FvH4_5g34340

regulation of parkin-mediated stimulation of mitophagy in response to mitochondrial depolarization

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
25018296 .. 25024589
6294 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g34340.t1

Sequence Viewer

Length: 234 bp
ATGCGACTGAGGAACACACCATCATCTGCTGAATTGAAGATCTCAGGAACCAACTTTCGCAGTTCAGCTCCTATTGGTGAAACCCAGCACAAGTCTGAAATTCATCCCTTGATTGATATTCTACGCATGAGGACATTGGAGCCATCATTATTGGGAACTGCTTTGATGGAAGGTGGCCCAGACAGAAAGATTAAGCTTGATCACAGTCCTGCTGTTGATGAGATTACCGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.49

Weight (kDa)

6.27

Isoelectric Point (pI)

40.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 99
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 2 cut(s) 68, 196
AluI AGCT 2 cut(s) 68, 196
AoxI GGCC 1 cut(s) 175
ApoI RAATTY 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 89
BccI CCATC 3 cut(s) 28, 151, 160
BclI TGATCA 1 cut(s) 199
BglII AGATCT 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 2 cut(s) 49, 141
BseGI GGATG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 57
BseYI CCCAGC 1 cut(s) 84
BshFI GGCC 1 cut(s) 177
BsnI GGCC 1 cut(s) 177
Bsp143I GATC 2 cut(s) 39, 199
BspANI GGCC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 56
BspLI GGNNCC 2 cut(s) 49, 141
BssMI GATC 2 cut(s) 39, 199
Bst4CI ACNGT 1 cut(s) 206
BstDEI CTNAG 2 cut(s) 8, 43
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 2 cut(s) 42, 202
BstMBI GATC 2 cut(s) 39, 199
BstX2I RGATCY 1 cut(s) 39
BstYI RGATCY 1 cut(s) 39
BsuRI GGCC 1 cut(s) 177
BtsCI GGATG 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 176
CviAII CATG 1 cut(s) 127
CviJI RGCY 4 cut(s) 68, 142, 177, 196
CviKI_1 RGCY 4 cut(s) 68, 142, 177, 196
DdeI CTNAG 2 cut(s) 8, 43
DpnI GATC 2 cut(s) 41, 201
DpnII GATC 2 cut(s) 39, 199
FaeI CATG 1 cut(s) 130
FaiI YATR 1 cut(s) 128
FatI CATG 1 cut(s) 126
FbaI TGATCA 1 cut(s) 199
FokI GGATG 1 cut(s) 90
GsaI CCCAGC 1 cut(s) 88
HaeIII GGCC 1 cut(s) 177
Hin1II CATG 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 194
HphI GGTGA 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 45
HpyAV CCTTC 1 cut(s) 164
HpyCH4III ACNGT 1 cut(s) 206
HpyF3I CTNAG 2 cut(s) 8, 43
Hsp92II CATG 1 cut(s) 130
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 2 cut(s) 39, 199
LmnI GCTCC 2 cut(s) 73, 139
LpnPI CCDG 4 cut(s) 30, 98, 192, 222
MalI GATC 2 cut(s) 41, 201
MboI GATC 2 cut(s) 39, 199
MboII GAAGA 1 cut(s) 49
MflI RGATCY 1 cut(s) 39
MluCI AATT 2 cut(s) 32, 99
MnlI CCTC 2 cut(s) 3, 123
MseI TTAA 1 cut(s) 192
NdeII GATC 2 cut(s) 39, 199
NlaIII CATG 1 cut(s) 130
NlaIV GGNNCC 2 cut(s) 49, 141
PspFI CCCAGC 1 cut(s) 84
PspN4I GGNNCC 2 cut(s) 49, 141
PspPI GGNCC 1 cut(s) 176
PsuI RGATCY 1 cut(s) 39
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 2 cut(s) 39, 199
Sau96I GGNCC 1 cut(s) 176
SetI ASST 3 cut(s) 70, 175, 198
SgeI CNNG 8 cut(s) 57, 97, 103, 121, 139, 191, 209, 221
Sse9I AATT 2 cut(s) 32, 99
TaaI ACNGT 1 cut(s) 206
TasI AATT 2 cut(s) 32, 99
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TspDTI ATGAA 1 cut(s) 92
XapI RAATTY 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.