FvH4_6g23630

Protein of unknown function (DUF1138)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0002659
Physical Location & Seq
Forward (+)
17708780 .. 17710661
1882 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g23630.t1

Sequence Viewer

Length: 246 bp
ATGGGCGGTGCGAAATACATCTTTCCTGCTGTGTTGGGATCATTTGCAGTGGCATGGGCATGTGATCATCTCATTGCTGACAAGAAGATATTTGGAGGAACTACTCCATCAACTGTTGCAAACAAAGAATGGTGGGAAGCTACTGACAAGAAGTTCCAGGCATGGCCTCGCACTGCCGGTCCACCTGTGGTCATGAATCCCATCAGTCGACAGAATTTCATTGTTAAGTCAAGCATTGATAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1138

Protein Analysis

82

Amino Acids

8.9

Weight (kDa)

9.52

Isoelectric Point (pI)

27.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1138 PF06592 4 - 76 9.4e-44 Protein of unknown function (DUF1138)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 208
AciI CCGC 1 cut(s) 6
AclWI GGATC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 214
AjnI CCWGG 1 cut(s) 156
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AlwI GGATC 1 cut(s) 46
AoxI GGCC 1 cut(s) 164
ApoI RAATTY 1 cut(s) 214
AspS9I GGNCC 1 cut(s) 179
AvaII GGWCC 1 cut(s) 179
BccI CCATC 2 cut(s) 115, 209
BciT130I CCWGG 1 cut(s) 158
BclI TGATCA 1 cut(s) 64
Bme1390I CCNGG 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 158
Bse118I RCCGGY 1 cut(s) 176
Bse3DI GCAATG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 158
BseMI GCAATG 1 cut(s) 72
BshFI GGCC 1 cut(s) 166
BsiSI CCGG 1 cut(s) 177
BsnI GGCC 1 cut(s) 166
Bsp143I GATC 2 cut(s) 38, 64
BspACI CCGC 1 cut(s) 6
BspANI GGCC 1 cut(s) 166
BspHI TCATGA 1 cut(s) 192
BspPI GGATC 1 cut(s) 46
BsrDI GCAATG 1 cut(s) 72
BsrFI RCCGGY 1 cut(s) 176
BssAI RCCGGY 1 cut(s) 176
BssMI GATC 2 cut(s) 38, 64
Bst2UI CCWGG 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 115
BstKTI GATC 2 cut(s) 41, 67
BstMBI GATC 2 cut(s) 38, 64
BstNI CCWGG 1 cut(s) 158
BstNSI RCATGY 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 156
BsuRI GGCC 1 cut(s) 166
BtsI GCAGTG 2 cut(s) 54, 171
BtsIMutI CAGTG 2 cut(s) 54, 171
CciI TCATGA 1 cut(s) 192
Cfr10I RCCGGY 1 cut(s) 176
Cfr13I GGNCC 1 cut(s) 179
CviAII CATG 4 cut(s) 54, 60, 162, 193
CviJI RGCY 2 cut(s) 140, 166
CviKI_1 RGCY 2 cut(s) 140, 166
DpnI GATC 2 cut(s) 40, 66
DpnII GATC 2 cut(s) 38, 64
Eco47I GGWCC 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 156
FaeI CATG 4 cut(s) 57, 63, 165, 196
FaiI YATR 4 cut(s) 55, 61, 163, 194
FatI CATG 4 cut(s) 53, 59, 161, 192
FbaI TGATCA 1 cut(s) 64
FblI GTMKAC 1 cut(s) 208
HaeIII GGCC 1 cut(s) 166
HapII CCGG 1 cut(s) 177
Hin1II CATG 4 cut(s) 57, 63, 165, 196
HincII GTYRAC 1 cut(s) 209
HindII GTYRAC 1 cut(s) 209
HinfI GANTC 1 cut(s) 196
HpaII CCGG 1 cut(s) 177
Hpy166II GTNNAC 2 cut(s) 182, 209
Hpy188III TCNNGA 1 cut(s) 193
Hpy8I GTNNAC 2 cut(s) 182, 209
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 47, 119
Hsp92II CATG 4 cut(s) 57, 63, 165, 196
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 2 cut(s) 38, 64
LpnPI CCDG 5 cut(s) 39, 143, 170, 190, 198
MalI GATC 2 cut(s) 40, 66
MboI GATC 2 cut(s) 38, 64
MboII GAAGA 1 cut(s) 97
MluCI AATT 1 cut(s) 214
MnlI CCTC 2 cut(s) 89, 177
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 1 cut(s) 58
MspI CCGG 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
NdeII GATC 2 cut(s) 38, 64
NlaIII CATG 4 cut(s) 57, 63, 165, 196
NspI RCATGY 1 cut(s) 63
PagI TCATGA 1 cut(s) 192
PfeI GAWTC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
PspPI GGNCC 1 cut(s) 179
RseI CAYNNNNRTG 1 cut(s) 58
SalI GTCGAC 1 cut(s) 207
SaqAI TTAA 1 cut(s) 225
Sau3AI GATC 2 cut(s) 38, 64
Sau96I GGNCC 1 cut(s) 179
ScrFI CCNGG 1 cut(s) 158
SetI ASST 2 cut(s) 142, 187
SinI GGWCC 1 cut(s) 179
SmiMI CAYNNNNRTG 1 cut(s) 58
Sse9I AATT 1 cut(s) 214
SsiI CCGC 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 115
TaqI TCGA 1 cut(s) 208
TasI AATT 1 cut(s) 214
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TscAI CASTG 2 cut(s) 54, 178
TspDTI ATGAA 2 cut(s) 208, 209
TspRI CASTG 2 cut(s) 54, 178
VpaK11BI GGWCC 1 cut(s) 179
XapI RAATTY 1 cut(s) 214
XceI RCATGY 1 cut(s) 63
XmiI GTMKAC 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.