Rh3CG276900

Protein of unknown function (DUF1138)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0002659
Physical Location & Seq
Forward (+)
27586634 .. 27589371
2738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG276900.1

Sequence Viewer

Length: 315 bp
ATGATATCAACCAATAAGGACTCAAGGAGGAGAAGAATCAAGACTTCCAGAGAGCTCCATTGTTTGAAGATGGGCCACGCGAAATACATCTTTCCTGCTGTGTTGGGATCATTTGCAGTGGCATGGGCATTTGACCATTTTGTTGCTGACAAGAAGATATTTGGAGGAACTACTCCATCAACTGTTGCAAACAAAGAATGGTGGGAAGCAACTGACAAGAAGTTCCAGGCATGGCCTCGCACTGCTGGTCCACCTGTGGTCATGAATCCCATCAGTCGTCAGAATTTCATTGTGAAGTCAGGCACCGATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1138

Protein Analysis

104

Amino Acids

11.81

Weight (kDa)

10.08

Isoelectric Point (pI)

41.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1138 PF06592 27 - 99 1.5e-42 Protein of unknown function (DUF1138)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 302
AccII CGCG 1 cut(s) 80
AclWI GGATC 1 cut(s) 115
AcsI RAATTY 1 cut(s) 283
AgsI TTSAA 1 cut(s) 67
AjnI CCWGG 1 cut(s) 225
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
Alw21I GWGCWC 1 cut(s) 57
AlwI GGATC 1 cut(s) 115
AoxI GGCC 2 cut(s) 73, 233
ApoI RAATTY 1 cut(s) 283
AspS9I GGNCC 2 cut(s) 73, 248
AvaII GGWCC 1 cut(s) 248
BanI GGYRCC 1 cut(s) 302
BanII GRGCYC 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 57
BccI CCATC 3 cut(s) 64, 184, 278
BciT130I CCWGG 1 cut(s) 227
Bme1390I CCNGG 1 cut(s) 227
Bme18I GGWCC 1 cut(s) 248
BmgT120I GGNCC 2 cut(s) 73, 248
BmiI GGNNCC 1 cut(s) 304
BmrFI CCNGG 1 cut(s) 227
BpuEI CTTGAG 1 cut(s) 7
BseBI CCWGG 1 cut(s) 227
BseRI GAGGAG 1 cut(s) 43
Bsh1236I CGCG 1 cut(s) 80
BshFI GGCC 2 cut(s) 75, 235
BshNI GGYRCC 1 cut(s) 302
BsiHKAI GWGCWC 1 cut(s) 57
BsnI GGCC 2 cut(s) 75, 235
Bsp1286I GDGCHC 1 cut(s) 57
Bsp143I GATC 1 cut(s) 107
BspANI GGCC 2 cut(s) 75, 235
BspFNI CGCG 1 cut(s) 80
BspHI TCATGA 1 cut(s) 261
BspLI GGNNCC 1 cut(s) 304
BspPI GGATC 1 cut(s) 115
BspT107I GGYRCC 1 cut(s) 302
BssMI GATC 1 cut(s) 107
Bst2UI CCWGG 1 cut(s) 227
Bst4CI ACNGT 1 cut(s) 184
BstFNI CGCG 1 cut(s) 80
BstKTI GATC 1 cut(s) 110
BstMBI GATC 1 cut(s) 107
BstNI CCWGG 1 cut(s) 227
BstSCI CCNGG 1 cut(s) 225
BstUI CGCG 1 cut(s) 80
BsuRI GGCC 2 cut(s) 75, 235
BtsI GCAGTG 2 cut(s) 123, 240
BtsIMutI CAGTG 2 cut(s) 123, 240
CciI TCATGA 1 cut(s) 261
Cfr13I GGNCC 2 cut(s) 73, 248
CviAII CATG 3 cut(s) 123, 231, 262
CviJI RGCY 3 cut(s) 55, 75, 235
CviKI_1 RGCY 3 cut(s) 55, 75, 235
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
Ecl136II GAGCTC 1 cut(s) 55
Eco24I GRGCYC 1 cut(s) 57
Eco32I GATATC 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 248
Eco53kI GAGCTC 1 cut(s) 55
EcoICRI GAGCTC 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 225
EcoRV GATATC 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 57
FaeI CATG 3 cut(s) 126, 234, 265
FaiI YATR 3 cut(s) 124, 232, 263
FatI CATG 3 cut(s) 122, 230, 261
FriOI GRGCYC 1 cut(s) 57
HaeIII GGCC 2 cut(s) 75, 235
Hin1II CATG 3 cut(s) 126, 234, 265
HinfI GANTC 3 cut(s) 20, 36, 265
Hpy166II GTNNAC 1 cut(s) 251
Hpy188I TCNGA 1 cut(s) 282
Hpy188III TCNNGA 3 cut(s) 40, 48, 262
Hpy8I GTNNAC 1 cut(s) 251
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4V TGCA 2 cut(s) 116, 188
Hsp92II CATG 3 cut(s) 126, 234, 265
Kzo9I GATC 1 cut(s) 107
LmnI GCTCC 1 cut(s) 60
LpnPI CCDG 7 cut(s) 61, 108, 212, 231, 239, 267, 285
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MboII GAAGA 3 cut(s) 45, 79, 166
MhlI GDGCHC 1 cut(s) 57
MluCI AATT 1 cut(s) 283
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 3 cut(s) 21, 158, 246
MspR9I CCNGG 1 cut(s) 227
MvaI CCWGG 1 cut(s) 227
MvnI CGCG 1 cut(s) 80
NdeII GATC 1 cut(s) 107
NlaIII CATG 3 cut(s) 126, 234, 265
NlaIV GGNNCC 1 cut(s) 304
PagI TCATGA 1 cut(s) 261
PfeI GAWTC 2 cut(s) 36, 265
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
Psp124BI GAGCTC 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 304
PspPI GGNCC 2 cut(s) 73, 248
SacI GAGCTC 1 cut(s) 57
Sau3AI GATC 1 cut(s) 107
Sau96I GGNCC 2 cut(s) 73, 248
SchI GAGTC 1 cut(s) 14
ScrFI CCNGG 1 cut(s) 227
SduI GDGCHC 1 cut(s) 57
SetI ASST 2 cut(s) 57, 256
SinI GGWCC 1 cut(s) 248
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 1 cut(s) 283
SstI GAGCTC 1 cut(s) 57
StyD4I CCNGG 1 cut(s) 225
TaaI ACNGT 1 cut(s) 184
TasI AATT 1 cut(s) 283
TfiI GAWTC 2 cut(s) 36, 265
TscAI CASTG 2 cut(s) 123, 247
TspDTI ATGAA 2 cut(s) 277, 278
TspRI CASTG 2 cut(s) 123, 247
VpaK11BI GGWCC 1 cut(s) 248
XapI RAATTY 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.