Rh3DG273000

Protein of unknown function (DUF1138)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0002659
Physical Location & Seq
Forward (+)
27488960 .. 27489694
735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG273000.1

Sequence Viewer

Length: 276 bp
ATGCAGTCCTTGTTAATTAATTGTTTAAAGATGGGCCACGCGAAATACATCTTTCCTGCTGTGTTGGGATCATTTGCAGTGGCATGGGCATTTGACCATTTTGTTGCTGACAAGAAGATATTTGGAGGAACTACTCCATCAACTGTTGCAAACAAAGAATGGTGGGAAGCAACTGACAAGAAGTTCCAGGCATGGCCTCGCACTGCCGGTCCACCTGTGGTCATGAATCCCATCAGTCGTCAGAATTTCATTGTGAAGTCAGGCACCGATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1138

Protein Analysis

91

Amino Acids

10.14

Weight (kDa)

9.25

Isoelectric Point (pI)

24.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1138 PF06592 14 - 86 9.6e-43 Protein of unknown function (DUF1138)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 263
AccII CGCG 1 cut(s) 41
AclWI GGATC 1 cut(s) 76
AcsI RAATTY 1 cut(s) 244
AjnI CCWGG 1 cut(s) 186
AlwI GGATC 1 cut(s) 76
AoxI GGCC 2 cut(s) 34, 194
ApoI RAATTY 1 cut(s) 244
AseI ATTAAT 1 cut(s) 18
AspS9I GGNCC 2 cut(s) 34, 209
AvaII GGWCC 1 cut(s) 209
BanI GGYRCC 1 cut(s) 263
BccI CCATC 3 cut(s) 25, 145, 239
BciT130I CCWGG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 188
Bme18I GGWCC 1 cut(s) 209
BmgT120I GGNCC 2 cut(s) 34, 209
BmiI GGNNCC 1 cut(s) 265
BmrFI CCNGG 1 cut(s) 188
Bse118I RCCGGY 1 cut(s) 206
BseBI CCWGG 1 cut(s) 188
Bsh1236I CGCG 1 cut(s) 41
BshFI GGCC 2 cut(s) 36, 196
BshNI GGYRCC 1 cut(s) 263
BsiSI CCGG 1 cut(s) 207
BsnI GGCC 2 cut(s) 36, 196
Bsp143I GATC 1 cut(s) 68
BspANI GGCC 2 cut(s) 36, 196
BspFNI CGCG 1 cut(s) 41
BspHI TCATGA 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 265
BspPI GGATC 1 cut(s) 76
BspT107I GGYRCC 1 cut(s) 263
BsrFI RCCGGY 1 cut(s) 206
BssAI RCCGGY 1 cut(s) 206
BssMI GATC 1 cut(s) 68
Bst2UI CCWGG 1 cut(s) 188
Bst4CI ACNGT 1 cut(s) 145
BstFNI CGCG 1 cut(s) 41
BstKTI GATC 1 cut(s) 71
BstMBI GATC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 186
BstUI CGCG 1 cut(s) 41
BsuRI GGCC 2 cut(s) 36, 196
BtsI GCAGTG 2 cut(s) 84, 201
BtsIMutI CAGTG 2 cut(s) 84, 201
CciI TCATGA 1 cut(s) 222
Cfr10I RCCGGY 1 cut(s) 206
Cfr13I GGNCC 2 cut(s) 34, 209
CviAII CATG 3 cut(s) 84, 192, 223
CviJI RGCY 2 cut(s) 36, 196
CviKI_1 RGCY 2 cut(s) 36, 196
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
DraI TTTAAA 1 cut(s) 27
Eco47I GGWCC 1 cut(s) 209
EcoRII CCWGG 1 cut(s) 186
FaeI CATG 3 cut(s) 87, 195, 226
FaiI YATR 3 cut(s) 85, 193, 224
FatI CATG 3 cut(s) 83, 191, 222
HaeIII GGCC 2 cut(s) 36, 196
HapII CCGG 1 cut(s) 207
Hin1II CATG 3 cut(s) 87, 195, 226
HinfI GANTC 1 cut(s) 226
HpaII CCGG 1 cut(s) 207
Hpy166II GTNNAC 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 243
Hpy188III TCNNGA 1 cut(s) 223
Hpy8I GTNNAC 1 cut(s) 212
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4V TGCA 3 cut(s) 4, 77, 149
Hsp92II CATG 3 cut(s) 87, 195, 226
Kzo9I GATC 1 cut(s) 68
LpnPI CCDG 6 cut(s) 69, 173, 200, 220, 228, 246
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MboII GAAGA 1 cut(s) 127
MluCI AATT 3 cut(s) 15, 19, 244
MnlI CCTC 2 cut(s) 119, 207
MseI TTAA 3 cut(s) 14, 18, 26
MspI CCGG 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 188
MvaI CCWGG 1 cut(s) 188
MvnI CGCG 1 cut(s) 41
NdeII GATC 1 cut(s) 68
NlaIII CATG 3 cut(s) 87, 195, 226
NlaIV GGNNCC 1 cut(s) 265
PacI TTAATTAA 1 cut(s) 18
PagI TCATGA 1 cut(s) 222
PfeI GAWTC 1 cut(s) 226
PshBI ATTAAT 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 186
PspGI CCWGG 1 cut(s) 186
PspN4I GGNNCC 1 cut(s) 265
PspPI GGNCC 2 cut(s) 34, 209
SaqAI TTAA 3 cut(s) 14, 18, 26
Sau3AI GATC 1 cut(s) 68
Sau96I GGNCC 2 cut(s) 34, 209
ScrFI CCNGG 1 cut(s) 188
SetI ASST 1 cut(s) 217
SinI GGWCC 1 cut(s) 209
Sse9I AATT 3 cut(s) 15, 19, 244
StyD4I CCNGG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 145
TasI AATT 3 cut(s) 15, 19, 244
TfiI GAWTC 1 cut(s) 226
Tru1I TTAA 3 cut(s) 14, 18, 26
Tru9I TTAA 3 cut(s) 14, 18, 26
TscAI CASTG 2 cut(s) 84, 208
TspDTI ATGAA 2 cut(s) 238, 239
TspRI CASTG 2 cut(s) 84, 208
VpaK11BI GGWCC 1 cut(s) 209
VspI ATTAAT 1 cut(s) 18
XapI RAATTY 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.