Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb7

Orthogroup ID

OG0004193

Physical Location & Seq

Genomic Coordinates Reverse (-)

8996385 .. 8998067

Gene Structure 1683 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_7g09340.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

ATGGCAGAGCTAGAGAACCCAATTGTGATGAACAAGACCATCACATTCCTATCTTCTTTGGTTCAGAGAGTAGCTGAATCAAATGATCTGAATTCTCAGTTCCAAATACAGAAAGTCTCAGTCTTCCATGGTCTAACTAGACCTACAATTTCCATTCAGAGCTATCTAGAGAGGATCTTCAAGTATGCAAATTGCAGCCCTTCTTGCTTAATCGTTGCTTACGTTTATCTCGATCGGTTTACTCAGAAGCAGCCCTCCTTGCCTATCAATTCGTTCAACGTTCATCGGTTGCTGATCACTAGTGTCATGGTGGCTGCAAAATTCATGGATGATCTGTACTACAACAATGCTTATTATGCTAAAGTTGGAGGGATCAGCACAGCAGAGATGAATTTTCTTGAAGTGGATTTCCTATTTGGTTTGAGCTTCAACTTGAATGTGACCCCCACAACCTTCACCACCTACTGTTCCTACCTTCAAAGGGAAATGCTTATGTTGCAACCTCCTCTACAGTCATCAATAGATTCTTCTCTTAGTTTGGGGAAATCACTAAAGCTCCATTTGTGCTTTGATGAGGATGACCCCTCACATAAGCAACAGCAACTTGCTGTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cyclin

Protein Analysis

205

Amino Acids

23.21

Weight (kDa)

6.06

Isoelectric Point (pI)

41.98

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Cyclin	PF08613	28 - 145	4.7e-41	Cyclin
Cyclin_N	PF00134	52 - 146	4.4e-12	Cyclin, N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004193)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G44740
fragaria_vesca	FvH4_7g09340 FvH4_7g26790
malus_domestica	MD02G1219700.v1.1 MD07G1097400.v1.1
prunus_persica	Prupe.2G121600_v2.0.a1 Prupe.2G271100_v2.0.a1 Prupe.6G140600_v2.0.a1
pyrus_communis	pycom01g18680 pycom02g18080 pycom07g08020 pycom07g22110
rosa_chinensis	RchiOBHm_Chr1g0345981 RchiOBHm_Chr1g0373481
rosa_laevigata	RLG00000026823 RLG00000028827
rosa_multiflora	Rmu_co8438935.1_g000001 Rmu_sc0008115.1_g000007 Rmu_sc0019006.1_g000005
rosa_roxburghii	Rroxscaffold_4G00284220 Rroxscaffold_4G00308970
rosa_rugosa	Rorug01G0377600
rosa_samantha	Rh1AG196400 Rh1AG386800 Rh1BG161900 Rh1BG351100 Rh1CG181300 Rh1CG363900 Rh1DG192200 Rh1DG381600
rosa_wichuraiana	Rw1G016410 Rw1G016510 Rw1G034850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	279
AclWI	GGATC	2 cut(s)	182, 380
AcsI	RAATTY	3 cut(s)	91, 320, 391
AfaI	GTAC	1 cut(s)	338
AfiI	CCNNNNNNNGG	1 cut(s)	481
AgsI	TTSAA	6 cut(s)	181, 277, 401, 430, 436, 479
AhlI	ACTAGT	1 cut(s)	299
AluBI	AGCT	5 cut(s)	10, 74, 162, 426, 556
AluI	AGCT	5 cut(s)	10, 74, 162, 426, 556
Alw26I	GTCTC	1 cut(s)	121
AlwI	GGATC	2 cut(s)	182, 380
ApeKI	GCWGC	3 cut(s)	195, 250, 314
ApoI	RAATTY	3 cut(s)	91, 320, 391
AsuHPI	GGTGA	1 cut(s)	448
BbsI	GAAGAC	1 cut(s)	115
BbvI	GCAGC	3 cut(s)	207, 262, 301
BccI	CCATC	1 cut(s)	47
BclI	TGATCA	1 cut(s)	294
BcoDI	GTCTC	1 cut(s)	121
BcuI	ACTAGT	1 cut(s)	299
BfaI	CTAG	4 cut(s)	11, 138, 167, 300
BfmI	CTRYAG	1 cut(s)	509
BisI	GCNGC	3 cut(s)	196, 251, 315
BlsI	GCNGC	3 cut(s)	197, 252, 316
BpiI	GAAGAC	1 cut(s)	115
BsaJI	CCNNGG	1 cut(s)	127
BsaXI	ACNNNNNCTCC	2 cut(s)	540, 570
Bsc4I	CCNNNNNNNGG	1 cut(s)	481
BseDI	CCNNGG	1 cut(s)	127
BseGI	GGATG	2 cut(s)	334, 583
BseLI	CCNNNNNNNGG	1 cut(s)	481
BseMII	CTCAG	3 cut(s)	110, 132, 257
BseRI	GAGGAG	1 cut(s)	495
BseXI	GCAGC	3 cut(s)	207, 262, 301
Bsh1285I	CGRYCG	1 cut(s)	235
BsiEI	CGRYCG	1 cut(s)	235
BslI	CCNNNNNNNGG	1 cut(s)	481
BsmAI	GTCTC	1 cut(s)	121
Bsp143I	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
Bsp19I	CCATGG	1 cut(s)	127
BspCNI	CTCAG	3 cut(s)	109, 131, 256
BspPI	GGATC	2 cut(s)	182, 380
BssECI	CCNNGG	1 cut(s)	127
BssMI	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
BssT1I	CCWWGG	1 cut(s)	127
Bst4CI	ACNGT	2 cut(s)	467, 513
BstDEI	CTNAG	4 cut(s)	96, 118, 243, 533
BstDSI	CCRYGG	1 cut(s)	127
BstF5I	GGATG	2 cut(s)	334, 583
BstKTI	GATC	6 cut(s)	88, 177, 235, 297, 334, 375
BstMAI	GTCTC	1 cut(s)	121
BstMBI	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
BstMCI	CGRYCG	1 cut(s)	235
BstMWI	GCNNNNNNNGC	4 cut(s)	204, 259, 356, 496
BstSFI	CTRYAG	1 cut(s)	509
BstV1I	GCAGC	3 cut(s)	207, 262, 301
BstV2I	GAAGAC	1 cut(s)	115
BstX2I	RGATCY	1 cut(s)	174
BstYI	RGATCY	1 cut(s)	174
BtgI	CCRYGG	1 cut(s)	127
BtsCI	GGATG	2 cut(s)	334, 583
Csp6I	GTAC	1 cut(s)	337
CviAII	CATG	3 cut(s)	128, 307, 325
CviJI	RGCY	8 cut(s)	10, 74, 162, 198, 253, 314, 426, 556
CviKI_1	RGCY	8 cut(s)	10, 74, 162, 198, 253, 314, 426, 556
CviQI	GTAC	1 cut(s)	337
DdeI	CTNAG	4 cut(s)	96, 118, 243, 533
DpnI	GATC	6 cut(s)	87, 176, 234, 296, 333, 374
DpnII	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
Eco130I	CCWWGG	1 cut(s)	127
EcoRI	GAATTC	1 cut(s)	91
EcoT14I	CCWWGG	1 cut(s)	127
ErhI	CCWWGG	1 cut(s)	127
FaeI	CATG	3 cut(s)	131, 310, 328
FaiI	YATR	7 cut(s)	129, 186, 308, 326, 357, 494, 591
FatI	CATG	3 cut(s)	127, 306, 324
FbaI	TGATCA	1 cut(s)	294
Fnu4HI	GCNGC	3 cut(s)	196, 251, 315
FokI	GGATG	2 cut(s)	341, 590
Fsp4HI	GCNGC	3 cut(s)	196, 251, 315
FspBI	CTAG	4 cut(s)	11, 138, 167, 300
GluI	GCNGC	3 cut(s)	196, 251, 315
Hin1II	CATG	3 cut(s)	131, 310, 328
HinfI	GANTC	2 cut(s)	77, 524
HphI	GGTGA	1 cut(s)	448
Hpy166II	GTNNAC	1 cut(s)	240
Hpy188I	TCNGA	4 cut(s)	66, 90, 159, 246
Hpy188III	TCNNGA	3 cut(s)	167, 230, 398
Hpy8I	GTNNAC	1 cut(s)	240
HpyAV	CCTTC	3 cut(s)	210, 463, 485
HpyCH4III	ACNGT	2 cut(s)	467, 513
HpyCH4IV	ACGT	2 cut(s)	222, 279
HpyCH4V	TGCA	4 cut(s)	188, 195, 317, 499
HpyF10VI	GCNNNNNNNGC	4 cut(s)	204, 259, 356, 496
HpyF3I	CTNAG	4 cut(s)	96, 118, 243, 533
HpySE526I	ACGT	2 cut(s)	222, 279
Hsp92II	CATG	3 cut(s)	131, 310, 328
Ksp22I	TGATCA	1 cut(s)	294
Kzo9I	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
LmnI	GCTCC	1 cut(s)	561
Lsp1109I	GCAGC	3 cut(s)	207, 262, 301
MaeI	CTAG	4 cut(s)	11, 138, 167, 300
MaeII	ACGT	2 cut(s)	222, 279
MaeIII	GTNAC	1 cut(s)	439
MalI	GATC	6 cut(s)	87, 176, 234, 296, 333, 374
MboI	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
MboII	GAAGA	4 cut(s)	45, 115, 169, 519
MfeI	CAATTG	1 cut(s)	21
MflI	RGATCY	1 cut(s)	174
MluCI	AATT	7 cut(s)	21, 91, 147, 190, 268, 320, 391
MmeI	TCCRAC	1 cut(s)	346
MnlI	CCTC	7 cut(s)	165, 265, 362, 513, 516, 568, 595
MseI	TTAA	1 cut(s)	209
MunI	CAATTG	1 cut(s)	21
MwoI	GCNNNNNNNGC	4 cut(s)	204, 259, 356, 496
NcoI	CCATGG	1 cut(s)	127
NdeII	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
NlaIII	CATG	3 cut(s)	131, 310, 328
NmuCI	GTSAC	1 cut(s)	439
PcsI	WCGNNNNNNNCGW	2 cut(s)	219, 228
PfeI	GAWTC	2 cut(s)	77, 524
PkrI	GCNGC	3 cut(s)	197, 252, 316
Ple19I	CGATCG	1 cut(s)	235
Psp1406I	AACGTT	1 cut(s)	279
PsuI	RGATCY	1 cut(s)	174
PvuI	CGATCG	1 cut(s)	235
RsaI	GTAC	1 cut(s)	338
RsaNI	GTAC	1 cut(s)	337
SaqAI	TTAA	1 cut(s)	209
SatI	GCNGC	3 cut(s)	196, 251, 315
Sau3AI	GATC	6 cut(s)	85, 174, 232, 294, 331, 372
SfcI	CTRYAG	1 cut(s)	509
SpeI	ACTAGT	1 cut(s)	299
Sse9I	AATT	7 cut(s)	21, 91, 147, 190, 268, 320, 391
SspMI	CTAG	4 cut(s)	11, 138, 167, 300
StyI	CCWWGG	1 cut(s)	127
TaaI	ACNGT	2 cut(s)	467, 513
TaiI	ACGT	2 cut(s)	225, 282
TaqI	TCGA	1 cut(s)	231
TasI	AATT	7 cut(s)	21, 91, 147, 190, 268, 320, 391
TatI	WGTACW	1 cut(s)	336
TfiI	GAWTC	2 cut(s)	77, 524
Tru1I	TTAA	1 cut(s)	209
Tru9I	TTAA	1 cut(s)	209
TseFI	GTSAC	1 cut(s)	439
TseI	GCWGC	3 cut(s)	195, 250, 314
Tsp45I	GTSAC	1 cut(s)	439
TspDTI	ATGAA	4 cut(s)	44, 272, 313, 404
XapI	RAATTY	3 cut(s)	91, 320, 391
XbaI	TCTAGA	1 cut(s)	166
XspI	CTAG	4 cut(s)	11, 138, 167, 300

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.