Rmu_co8438935.1_g000001

Cyclin

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8438935.1
Physical Location & Seq
Forward (+)
153 .. 1427
1275 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8438935.1_g000001.1.cds

Sequence Viewer

Length: 612 bp
atggcagagctagagaatccaattgtgatgaacaagatcattacattcctctcttctttggttcagagagtagctgaatcaaatgatctcaattctcagttccaaatccagaaagtctcagtcttccatggtctaactagacctacgatttcaattcagagctacctagagaggatcttcaagtatgcaaattgcagcccttcttgcttaatcgtcgcatatgtttatctcgatcggtttactcagaagcagccctccttgcctatcaattcgttcaacgttcatcggttgctgattactagtgtcatggtggctgcaaaattcatggatgatatgtactacaataatgcttattatgcaaaagttggggggatcagcacagcagagatgaattttcttgaagtggatttcctatttggtttgagcttcaacttgaatgtgactcccacaaccttcaccacctactgttcctaccttcaaagggaaatgcttctgttgcaacctcctctagattccatagattcttctctcagtttgggaaaatcactaaagctccatttgtgctttgatgaagatgacccctcacataagcaacggcaacttgctgtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

23.15

Weight (kDa)

6.06

Isoelectric Point (pI)

38.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 279
AclWI GGATC 2 cut(s) 182, 380
AcsI RAATTY 2 cut(s) 320, 391
AfaI GTAC 1 cut(s) 338
AfiI CCNNNNNNNGG 1 cut(s) 481
AgsI TTSAA 7 cut(s) 153, 181, 277, 401, 430, 436, 479
AhlI ACTAGT 1 cut(s) 299
AluBI AGCT 5 cut(s) 10, 74, 162, 426, 553
AluI AGCT 5 cut(s) 10, 74, 162, 426, 553
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 2 cut(s) 182, 380
ApeKI GCWGC 3 cut(s) 195, 250, 314
ApoI RAATTY 2 cut(s) 320, 391
Asp700I GAANNNNTTC 1 cut(s) 489
AsuHPI GGTGA 1 cut(s) 448
BbsI GAAGAC 1 cut(s) 115
BbvI GCAGC 3 cut(s) 207, 262, 301
BcoDI GTCTC 1 cut(s) 121
BcuI ACTAGT 1 cut(s) 299
BfaI CTAG 5 cut(s) 11, 138, 167, 300, 509
BisI GCNGC 3 cut(s) 196, 251, 315
BlsI GCNGC 3 cut(s) 197, 252, 316
BpiI GAAGAC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 127
BsaXI ACNNNNNCTCC 2 cut(s) 537, 567
Bsc4I CCNNNNNNNGG 1 cut(s) 481
BseDI CCNNGG 1 cut(s) 127
BseGI GGATG 1 cut(s) 334
BseLI CCNNNNNNNGG 1 cut(s) 481
BseMII CTCAG 4 cut(s) 110, 132, 257, 544
BseRI GAGGAG 1 cut(s) 495
BseXI GCAGC 3 cut(s) 207, 262, 301
Bsh1285I CGRYCG 1 cut(s) 235
BsiEI CGRYCG 1 cut(s) 235
BslI CCNNNNNNNGG 1 cut(s) 481
BsmAI GTCTC 1 cut(s) 121
Bsp143I GATC 5 cut(s) 36, 85, 174, 232, 372
Bsp19I CCATGG 1 cut(s) 127
BspCNI CTCAG 4 cut(s) 109, 131, 256, 543
BspPI GGATC 2 cut(s) 182, 380
BssECI CCNNGG 1 cut(s) 127
BssMI GATC 5 cut(s) 36, 85, 174, 232, 372
BssT1I CCWWGG 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 467
Bst6I CTCTTC 1 cut(s) 58
BstDEI CTNAG 4 cut(s) 96, 118, 243, 530
BstDSI CCRYGG 1 cut(s) 127
BstF5I GGATG 1 cut(s) 334
BstKTI GATC 5 cut(s) 39, 88, 177, 235, 375
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 5 cut(s) 36, 85, 174, 232, 372
BstMCI CGRYCG 1 cut(s) 235
BstMWI GCNNNNNNNGC 4 cut(s) 204, 259, 356, 496
BstV1I GCAGC 3 cut(s) 207, 262, 301
BstV2I GAAGAC 1 cut(s) 115
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 127
BtsCI GGATG 1 cut(s) 334
Csp6I GTAC 1 cut(s) 337
CviAII CATG 3 cut(s) 128, 307, 325
CviJI RGCY 8 cut(s) 10, 74, 162, 198, 253, 314, 426, 553
CviKI_1 RGCY 8 cut(s) 10, 74, 162, 198, 253, 314, 426, 553
CviQI GTAC 1 cut(s) 337
DdeI CTNAG 4 cut(s) 96, 118, 243, 530
DpnI GATC 5 cut(s) 38, 87, 176, 234, 374
DpnII GATC 5 cut(s) 36, 85, 174, 232, 372
Eam1104I CTCTTC 1 cut(s) 58
EarI CTCTTC 1 cut(s) 58
Eco130I CCWWGG 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 127
FaeI CATG 3 cut(s) 131, 310, 328
FatI CATG 3 cut(s) 127, 306, 324
FauNDI CATATG 1 cut(s) 220
Fnu4HI GCNGC 3 cut(s) 196, 251, 315
FokI GGATG 1 cut(s) 341
Fsp4HI GCNGC 3 cut(s) 196, 251, 315
FspBI CTAG 5 cut(s) 11, 138, 167, 300, 509
GluI GCNGC 3 cut(s) 196, 251, 315
Hin1II CATG 3 cut(s) 131, 310, 328
HinfI GANTC 5 cut(s) 16, 77, 442, 512, 521
HphI GGTGA 1 cut(s) 448
Hpy166II GTNNAC 1 cut(s) 240
Hpy188I TCNGA 3 cut(s) 66, 159, 246
Hpy188III TCNNGA 4 cut(s) 109, 230, 398, 509
Hpy8I GTNNAC 1 cut(s) 240
Hpy99I CGWCG 1 cut(s) 218
HpyAV CCTTC 3 cut(s) 210, 463, 485
HpyCH4III ACNGT 1 cut(s) 467
HpyCH4IV ACGT 1 cut(s) 279
HpyCH4V TGCA 5 cut(s) 188, 195, 317, 359, 499
HpyF10VI GCNNNNNNNGC 4 cut(s) 204, 259, 356, 496
HpyF3I CTNAG 4 cut(s) 96, 118, 243, 530
HpySE526I ACGT 1 cut(s) 279
Hsp92II CATG 3 cut(s) 131, 310, 328
Kzo9I GATC 5 cut(s) 36, 85, 174, 232, 372
LmnI GCTCC 1 cut(s) 558
LpnPI CCDG 1 cut(s) 122
Lsp1109I GCAGC 3 cut(s) 207, 262, 301
MaeI CTAG 5 cut(s) 11, 138, 167, 300, 509
MaeII ACGT 1 cut(s) 279
MaeIII GTNAC 1 cut(s) 439
MalI GATC 5 cut(s) 38, 87, 176, 234, 374
MboI GATC 5 cut(s) 36, 85, 174, 232, 372
MboII GAAGA 5 cut(s) 45, 115, 169, 516, 584
MfeI CAATTG 1 cut(s) 21
MflI RGATCY 1 cut(s) 174
MluCI AATT 7 cut(s) 21, 91, 153, 190, 268, 320, 391
MlyI GAGTC 1 cut(s) 436
MnlI CCTC 6 cut(s) 59, 165, 265, 513, 516, 592
MroXI GAANNNNTTC 1 cut(s) 489
MseI TTAA 1 cut(s) 209
MunI CAATTG 1 cut(s) 21
MwoI GCNNNNNNNGC 4 cut(s) 204, 259, 356, 496
NcoI CCATGG 1 cut(s) 127
NdeI CATATG 1 cut(s) 220
NdeII GATC 5 cut(s) 36, 85, 174, 232, 372
NlaIII CATG 3 cut(s) 131, 310, 328
NmuCI GTSAC 1 cut(s) 439
PdmI GAANNNNTTC 1 cut(s) 489
PfeI GAWTC 4 cut(s) 16, 77, 512, 521
PkrI GCNGC 3 cut(s) 197, 252, 316
Ple19I CGATCG 1 cut(s) 235
PleI GAGTC 1 cut(s) 436
PpsI GAGTC 1 cut(s) 436
Psp1406I AACGTT 1 cut(s) 279
PsuI RGATCY 1 cut(s) 174
PvuI CGATCG 1 cut(s) 235
RsaI GTAC 1 cut(s) 338
RsaNI GTAC 1 cut(s) 337
SaqAI TTAA 1 cut(s) 209
SatI GCNGC 3 cut(s) 196, 251, 315
Sau3AI GATC 5 cut(s) 36, 85, 174, 232, 372
SchI GAGTC 1 cut(s) 436
SpeI ACTAGT 1 cut(s) 299
Sse9I AATT 7 cut(s) 21, 91, 153, 190, 268, 320, 391
SspMI CTAG 5 cut(s) 11, 138, 167, 300, 509
StyI CCWWGG 1 cut(s) 127
TaaI ACNGT 1 cut(s) 467
TaiI ACGT 1 cut(s) 282
TaqI TCGA 1 cut(s) 231
TasI AATT 7 cut(s) 21, 91, 153, 190, 268, 320, 391
TatI WGTACW 1 cut(s) 336
TfiI GAWTC 4 cut(s) 16, 77, 512, 521
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TseFI GTSAC 1 cut(s) 439
TseI GCWGC 3 cut(s) 195, 250, 314
Tsp45I GTSAC 1 cut(s) 439
TspDTI ATGAA 5 cut(s) 44, 272, 313, 404, 585
XapI RAATTY 2 cut(s) 320, 391
XbaI TCTAGA 1 cut(s) 508
XmnI GAANNNNTTC 1 cut(s) 489
XspI CTAG 5 cut(s) 11, 138, 167, 300, 509
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.