MD00G1002200.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
450032 .. 451065
1034 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1002200.v1.1.491

Sequence Viewer

Length: 342 bp
ATGAAGCATTTTGTACTAAGGGAGTCGCCTTGGAAGCTAGATGGTGAGTCGACAAGAATATCCTCTAAGCTAAAATTACTTGAACTGGAATTACTGAATTTGGAAACTGTTGGAAAGAATGATATTTCAAAGTTACCTTCATTGATGAGGAAGCAGGCCAAGAGGTATCAAGCTCTTGCGGGGAAGATTGATGATCTGTGCAGAAGAATGCAAGGCAGTGATCCCTCCGAACCTACACTCAGTCCAGAGTTTCGTACGCAACGACAAACAGAATTTTTACTCGAATCATTTAGACTTCAACAACGTGCGACAGAAACTGGACAGAAGTTGATGGCAGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

13.06

Weight (kDa)

9.61

Isoelectric Point (pI)

44.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 50
AciI CCGC 1 cut(s) 179
AclWI GGATC 1 cut(s) 215
AcsI RAATTY 2 cut(s) 97, 272
AfaI GTAC 2 cut(s) 15, 256
AgsI TTSAA 3 cut(s) 83, 129, 299
AluBI AGCT 3 cut(s) 37, 70, 173
AluI AGCT 3 cut(s) 37, 70, 173
AlwI GGATC 1 cut(s) 215
AlwNI CAGNNNCTG 1 cut(s) 317
AoxI GGCC 1 cut(s) 156
ApoI RAATTY 2 cut(s) 97, 272
AsuHPI GGTGA 1 cut(s) 56
BccI CCATC 2 cut(s) 35, 325
BfaI CTAG 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 29
Bse1I ACTGG 2 cut(s) 90, 322
BseDI CCNNGG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 253
BseNI ACTGG 2 cut(s) 90, 322
BsgI GTGCAG 1 cut(s) 220
BshFI GGCC 1 cut(s) 158
BsiWI CGTACG 1 cut(s) 254
BsmI GAATGC 1 cut(s) 213
BsnI GGCC 1 cut(s) 158
Bsp143I GATC 2 cut(s) 193, 220
BspACI CCGC 1 cut(s) 179
BspANI GGCC 1 cut(s) 158
BspCNI CTCAG 1 cut(s) 252
BspPI GGATC 1 cut(s) 215
BsrI ACTGG 2 cut(s) 90, 322
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 2 cut(s) 193, 220
BssT1I CCWWGG 1 cut(s) 29
Bst4CI ACNGT 1 cut(s) 109
BstC8I GCNNGC 1 cut(s) 156
BstDEI CTNAG 3 cut(s) 17, 66, 239
BstKTI GATC 2 cut(s) 196, 223
BstMBI GATC 2 cut(s) 193, 220
BstMWI GCNNNNNNNGC 1 cut(s) 34
BsuRI GGCC 1 cut(s) 158
BtsI GCAGTG 1 cut(s) 223
BtsIMutI CAGTG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 156
CaiI CAGNNNCTG 1 cut(s) 317
Csp6I GTAC 2 cut(s) 14, 255
CviJI RGCY 4 cut(s) 37, 70, 158, 173
CviKI_1 RGCY 4 cut(s) 37, 70, 158, 173
CviQI GTAC 2 cut(s) 14, 255
DdeI CTNAG 3 cut(s) 17, 66, 239
DpnI GATC 2 cut(s) 195, 222
DpnII GATC 2 cut(s) 193, 220
Eco130I CCWWGG 1 cut(s) 29
EcoT14I CCWWGG 1 cut(s) 29
ErhI CCWWGG 1 cut(s) 29
FaiI YATR 1 cut(s) 340
FauI CCCGC 1 cut(s) 172
FblI GTMKAC 1 cut(s) 50
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 158
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HinfI GANTC 3 cut(s) 23, 47, 284
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 51
Hpy188I TCNGA 1 cut(s) 229
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 1 cut(s) 51
HpyAV CCTTC 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4IV ACGT 1 cut(s) 304
HpyCH4V TGCA 2 cut(s) 201, 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 3 cut(s) 17, 66, 239
HpySE526I ACGT 1 cut(s) 304
Kzo9I GATC 2 cut(s) 193, 220
LpnPI CCDG 4 cut(s) 71, 140, 258, 303
MaeI CTAG 1 cut(s) 38
MaeII ACGT 1 cut(s) 304
MaeIII GTNAC 1 cut(s) 132
MalI GATC 2 cut(s) 195, 222
MboI GATC 2 cut(s) 193, 220
MboII GAAGA 2 cut(s) 196, 216
MluCI AATT 4 cut(s) 74, 89, 97, 272
MlyI GAGTC 2 cut(s) 32, 56
MmeI TCCRAC 1 cut(s) 91
MnlI CCTC 4 cut(s) 73, 141, 156, 235
Mva1269I GAATGC 1 cut(s) 213
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeII GATC 2 cut(s) 193, 220
PcsI WCGNNNNNNNCGW 1 cut(s) 259
PctI GAATGC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 284
Pfl23II CGTACG 1 cut(s) 254
PleI GAGTC 2 cut(s) 31, 55
PpsI GAGTC 2 cut(s) 31, 55
PspLI CGTACG 1 cut(s) 254
PsrI GAACNNNNNNTAC 2 cut(s) 75, 107
PstNI CAGNNNCTG 1 cut(s) 317
RsaI GTAC 2 cut(s) 15, 256
RsaNI GTAC 2 cut(s) 14, 255
SalI GTCGAC 1 cut(s) 49
Sau3AI GATC 2 cut(s) 193, 220
SchI GAGTC 2 cut(s) 32, 56
SetI ASST 7 cut(s) 39, 72, 139, 167, 175, 235, 307
Sse9I AATT 4 cut(s) 74, 89, 97, 272
SsiI CCGC 1 cut(s) 179
SspMI CTAG 1 cut(s) 38
StyI CCWWGG 1 cut(s) 29
TaaI ACNGT 1 cut(s) 109
TaiI ACGT 1 cut(s) 307
TaqI TCGA 2 cut(s) 50, 282
TasI AATT 4 cut(s) 74, 89, 97, 272
TatI WGTACW 1 cut(s) 13
TfiI GAWTC 1 cut(s) 284
TscAI CASTG 1 cut(s) 223
TspDTI ATGAA 2 cut(s) 17, 129
TspRI CASTG 1 cut(s) 223
XapI RAATTY 2 cut(s) 97, 272
XmiI GTMKAC 1 cut(s) 50
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.