MD01G1004500.v1.1

NAD(P)H-quinone oxidoreductase subunit 2

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
1482922 .. 1483170
249 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1004500.v1.1.491

Sequence Viewer

Length: 249 bp
ATGGCTATAACAGAGTTTCTGTTATTCCTATTAATACCTACTCTAGGAGGAATGTTTTTATGTAGTGATAATGATTTAATGACTATCTTTGTAGCTCTAGAATGTTTCGGTTTACACTCTTGCCTATTATTTGGATATACCAAGAAAGATGTACGGTCTAATGAGGCTACTATGAAGTATTTACTCATGGGTGGGGCAAGCTTTTCTATTATGGTATGCACACAAATGTGTAACTCCCCAGGAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.03

Weight (kDa)

4.95

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Proton_antipo_M PF00361 24 - 73 3.1e-09 NADH:quinone oxidoreductase/Mrp antiporter, TM
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 243
AfaI GTAC 1 cut(s) 153
AfiI CCNNNNNNNGG 1 cut(s) 44
AjnI CCWGG 1 cut(s) 238
AleI CACNNNNGTG 1 cut(s) 226
AluBI AGCT 2 cut(s) 95, 201
AluI AGCT 2 cut(s) 95, 201
ApoI RAATTY 1 cut(s) 243
AseI ATTAAT 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 240
BfaI CTAG 2 cut(s) 44, 98
Bme1390I CCNGG 1 cut(s) 240
BmrFI CCNGG 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 238
Bsc4I CCNNNNNNNGG 1 cut(s) 44
BseBI CCWGG 1 cut(s) 240
BseDI CCNNGG 1 cut(s) 238
BseLI CCNNNNNNNGG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 238
Bst2UI CCWGG 1 cut(s) 240
Bst4CI ACNGT 1 cut(s) 156
BstC8I GCNNGC 1 cut(s) 199
BstENI CCTNNNNNAGG 1 cut(s) 42
BstNI CCWGG 1 cut(s) 240
BstSCI CCNGG 1 cut(s) 238
Cac8I GCNNGC 1 cut(s) 199
Csp6I GTAC 1 cut(s) 152
CviAII CATG 1 cut(s) 187
CviJI RGCY 4 cut(s) 5, 95, 167, 201
CviKI_1 RGCY 4 cut(s) 5, 95, 167, 201
CviQI GTAC 1 cut(s) 152
EcoNI CCTNNNNNAGG 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 238
FaeI CATG 1 cut(s) 190
FaiI YATR 7 cut(s) 8, 61, 138, 173, 188, 212, 217
FatI CATG 1 cut(s) 186
FspBI CTAG 2 cut(s) 44, 98
Hin1II CATG 1 cut(s) 190
HindIII AAGCTT 1 cut(s) 199
Hpy166II GTNNAC 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 219
Hsp92II CATG 1 cut(s) 190
LpnPI CCDG 1 cut(s) 225
MaeI CTAG 2 cut(s) 44, 98
MaeIII GTNAC 1 cut(s) 230
MluCI AATT 1 cut(s) 243
MnlI CCTC 2 cut(s) 41, 157
MseI TTAA 2 cut(s) 32, 77
MslI CAYNNNNRTG 2 cut(s) 224, 226
MspR9I CCNGG 1 cut(s) 240
MvaI CCWGG 1 cut(s) 240
NlaIII CATG 1 cut(s) 190
OliI CACNNNNGTG 1 cut(s) 226
PshBI ATTAAT 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
RsaI GTAC 1 cut(s) 153
RsaNI GTAC 1 cut(s) 152
RseI CAYNNNNRTG 2 cut(s) 224, 226
SaqAI TTAA 2 cut(s) 32, 77
ScrFI CCNGG 1 cut(s) 240
SetI ASST 3 cut(s) 40, 97, 203
SgeI CNNG 6 cut(s) 56, 110, 132, 154, 199, 210
SmiMI CAYNNNNRTG 2 cut(s) 224, 226
Sse9I AATT 1 cut(s) 243
SspMI CTAG 2 cut(s) 44, 98
StyD4I CCNGG 1 cut(s) 238
TaaI ACNGT 1 cut(s) 156
TasI AATT 1 cut(s) 243
Tru1I TTAA 2 cut(s) 32, 77
Tru9I TTAA 2 cut(s) 32, 77
TspDTI ATGAA 1 cut(s) 188
VspI ATTAAT 1 cut(s) 32
XagI CCTNNNNNAGG 1 cut(s) 42
XapI RAATTY 1 cut(s) 243
XbaI TCTAGA 1 cut(s) 97
XspI CTAG 2 cut(s) 44, 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.