RCHIOBHM_CPG0501751

Proton-conducting membrane transporter

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
Physical Location & Seq
Forward (+)
15161 .. 15870
710 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15672

Sequence Viewer

Length: 357 bp
ATGTATAACTCCCCAGGAATTTCAATTGCGCTTATATTCATCACTGTAGGAATTGGGTTCAAGCTTTCCCTAGCCCCTTCTCATCAATGGACTCCTGACGTATACGAAGGAATGCTACATAGTTGGTTCTCATCCTTCAGAGACTACGAGTGTAATAGGAGCATCCGTCGACAAAAGGATCACCCTAAGATGATCATCTCATGGCTATTGAGAACGAATCAAATCAGATGGTTCTATTTCTCAATCTTTCTGACTTGCTCCTACGGAACCGAGGTCGAAAAGATTGAGAAAAATCAGTCATTCACAACCACTGATGAAGGATTCCTCGAAAAGTTAAGGATTAGTAATCCTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.96

Weight (kDa)

8.62

Isoelectric Point (pI)

45.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Proton_antipo_M PF00361 1 - 37 1.4e-06 NADH:quinone oxidoreductase/Mrp antiporter, TM
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 102, 169
AclWI GGATC 1 cut(s) 186
AcsI RAATTY 1 cut(s) 18
AcuI CTGAAG 1 cut(s) 121
AgsI TTSAA 2 cut(s) 24, 61
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
Alw26I GTCTC 1 cut(s) 135
AlwI GGATC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 18
AspLEI GCGC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 173
BarI GAAGNNNNNNTAC 2 cut(s) 99, 131
BccI CCATC 1 cut(s) 222
BciT130I CCWGG 1 cut(s) 15
BclI TGATCA 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 135
BfaI CTAG 1 cut(s) 71
BfmI CTRYAG 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 268
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 171
BsaBI GATNNNNATC 1 cut(s) 194
BsaJI CCNNGG 2 cut(s) 13, 270
BsaXI ACNNNNNCTCC 2 cut(s) 151, 181
Bse8I GATNNNNATC 1 cut(s) 194
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 2 cut(s) 13, 270
BseGI GGATG 2 cut(s) 131, 162
BseJI GATNNNNATC 1 cut(s) 194
BsmAI GTCTC 1 cut(s) 135
BsmI GAATGC 1 cut(s) 117
Bsp143I GATC 2 cut(s) 178, 192
BspLI GGNNCC 1 cut(s) 268
BspPI GGATC 1 cut(s) 186
BssECI CCNNGG 2 cut(s) 13, 270
BssMI GATC 2 cut(s) 178, 192
BssNAI GTATAC 1 cut(s) 103
Bst1107I GTATAC 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 186
BstF5I GGATG 2 cut(s) 131, 162
BstHHI GCGC 1 cut(s) 31
BstKTI GATC 2 cut(s) 181, 195
BstMAI GTCTC 1 cut(s) 135
BstMBI GATC 2 cut(s) 178, 192
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 45
BstZ17I GTATAC 1 cut(s) 103
BtsCI GGATG 2 cut(s) 131, 162
BtsIMutI CAGTG 2 cut(s) 42, 309
CfoI GCGC 1 cut(s) 31
CviAII CATG 1 cut(s) 201
CviJI RGCY 3 cut(s) 64, 74, 205
CviKI_1 RGCY 3 cut(s) 64, 74, 205
DdeI CTNAG 1 cut(s) 186
DpnI GATC 2 cut(s) 180, 194
DpnII GATC 2 cut(s) 178, 192
Eco57I CTGAAG 1 cut(s) 121
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 1 cut(s) 204
FaiI YATR 5 cut(s) 6, 35, 103, 120, 202
FatI CATG 1 cut(s) 200
FbaI TGATCA 1 cut(s) 192
FblI GTMKAC 2 cut(s) 102, 169
FokI GGATG 2 cut(s) 118, 149
FspBI CTAG 1 cut(s) 71
GlaI GCGC 1 cut(s) 30
HhaI GCGC 1 cut(s) 31
Hin1II CATG 1 cut(s) 204
Hin6I GCGC 1 cut(s) 29
HinP1I GCGC 1 cut(s) 29
HincII GTYRAC 1 cut(s) 170
HindII GTYRAC 1 cut(s) 170
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 3 cut(s) 91, 217, 321
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 2 cut(s) 103, 170
Hpy188I TCNGA 3 cut(s) 140, 227, 252
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 2 cut(s) 103, 170
Hpy99I CGWCG 1 cut(s) 171
HpyAV CCTTC 4 cut(s) 87, 101, 145, 311
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 99
HpyF3I CTNAG 1 cut(s) 186
HpySE526I ACGT 1 cut(s) 99
Hsp92II CATG 1 cut(s) 204
HspAI GCGC 1 cut(s) 29
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 2 cut(s) 178, 192
LmnI GCTCC 2 cut(s) 159, 263
LpnPI CCDG 2 cut(s) 27, 108
LweI GCATC 1 cut(s) 171
MaeI CTAG 1 cut(s) 71
MaeII ACGT 1 cut(s) 99
MalI GATC 2 cut(s) 180, 194
MboI GATC 2 cut(s) 178, 192
MfeI CAATTG 1 cut(s) 24
MluCI AATT 3 cut(s) 18, 24, 51
MlyI GAGTC 1 cut(s) 85
MnlI CCTC 2 cut(s) 265, 335
MseI TTAA 1 cut(s) 335
MspR9I CCNGG 1 cut(s) 15
MunI CAATTG 1 cut(s) 24
Mva1269I GAATGC 1 cut(s) 117
MvaI CCWGG 1 cut(s) 15
NdeII GATC 2 cut(s) 178, 192
NlaIII CATG 1 cut(s) 204
NlaIV GGNNCC 1 cut(s) 268
PctI GAATGC 1 cut(s) 117
PfeI GAWTC 2 cut(s) 217, 321
PleI GAGTC 1 cut(s) 85
PpsI GAGTC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 268
SalI GTCGAC 1 cut(s) 168
SaqAI TTAA 1 cut(s) 335
Sau3AI GATC 2 cut(s) 178, 192
SchI GAGTC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 15
SetI ASST 3 cut(s) 66, 102, 276
SfaNI GCATC 1 cut(s) 171
SfcI CTRYAG 1 cut(s) 45
Sse9I AATT 3 cut(s) 18, 24, 51
SspMI CTAG 1 cut(s) 71
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 46
TaiI ACGT 1 cut(s) 102
TaqI TCGA 3 cut(s) 169, 276, 327
TasI AATT 3 cut(s) 18, 24, 51
TfiI GAWTC 2 cut(s) 217, 321
Tru1I TTAA 1 cut(s) 335
Tru9I TTAA 1 cut(s) 335
TscAI CASTG 2 cut(s) 49, 316
TspDTI ATGAA 2 cut(s) 28, 330
TspGWI ACGGA 2 cut(s) 155, 279
TspRI CASTG 2 cut(s) 49, 316
XapI RAATTY 1 cut(s) 18
XmiI GTMKAC 2 cut(s) 102, 169
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.