Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr01

Orthogroup ID

OG0008151

Physical Location & Seq

Genomic Coordinates Forward (+)

21447030 .. 21448190

Gene Structure 1161 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD01G1101600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

ATGCGTCTTCGGGGTGGTTTGGGAGTGAGCAACGCCTGGACAAAGGCAGTCCTAATATCGGATGACATCATTTTTTGGTATTTCAAATTATTCACTAATTGGGTTGCTCCTTTTATATATAGAGATTATTGTAGAATTATCAGAGAGACGGGTCATACGGCCCACTTCCAACAACACCGATATTGTTTCCAACTTGGTAATTACCACCAGCACAATCCGTTAGGTGTTGAGTTTTATCACAAAATGTCTCAGTATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

86

Amino Acids

10.3

Weight (kDa)

9.3

Isoelectric Point (pI)

24.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008151)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g31640
malus_domestica	MD01G1101600.v1.1 MD09G1210200.v1.1 MD14G1095100.v1.1
pyrus_communis	pycom09g12750 pycom11g24660 pycom15g23000
rosa_chinensis	RchiOBHm_Chr1g0340011 RchiOBHm_Chr1g0357081 RchiOBHm_Chr3g0486941 RchiOBHm_Chr4g0436351
rosa_multiflora	Rmu_sc0006243.1_g000012
rosa_roxburghii	Rroxscaffold_3G00220430 Rroxscaffold_7G00210400
rosa_samantha	Rh1CG218500 Rh1CG254900 Rh2DG070500 Rh5AG243700 Rh5AG243800 Rh6BG302100 Rh7AG161900 Rh7AG282400 Rh7CG016100 Rh7CG301700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	58
AgsI	TTSAA	1 cut(s)	85
AjnI	CCWGG	1 cut(s)	35
Alw26I	GTCTC	2 cut(s)	140, 252
AoxI	GGCC	1 cut(s)	159
AspS9I	GGNCC	1 cut(s)	160
BceAI	ACGGC	1 cut(s)	174
BciT130I	CCWGG	1 cut(s)	37
BcoDI	GTCTC	2 cut(s)	140, 252
Bme1390I	CCNGG	1 cut(s)	37
BmgT120I	GGNCC	1 cut(s)	160
BmrFI	CCNGG	1 cut(s)	37
Bsc4I	CCNNNNNNNGG	1 cut(s)	58
BseBI	CCWGG	1 cut(s)	37
BseGI	GGATG	1 cut(s)	67
BseLI	CCNNNNNNNGG	1 cut(s)	58
BshFI	GGCC	1 cut(s)	161
BslI	CCNNNNNNNGG	1 cut(s)	58
BsmAI	GTCTC	2 cut(s)	140, 252
BsmBI	CGTCTC	1 cut(s)	140
BsnI	GGCC	1 cut(s)	161
BspANI	GGCC	1 cut(s)	161
Bst2UI	CCWGG	1 cut(s)	37
BstDEI	CTNAG	1 cut(s)	249
BstF5I	GGATG	1 cut(s)	67
BstMAI	GTCTC	2 cut(s)	140, 252
BstNI	CCWGG	1 cut(s)	37
BstSCI	CCNGG	1 cut(s)	35
BsuRI	GGCC	1 cut(s)	161
BtsCI	GGATG	1 cut(s)	67
Cfr13I	GGNCC	1 cut(s)	160
CviJI	RGCY	1 cut(s)	161
CviKI_1	RGCY	1 cut(s)	161
DdeI	CTNAG	1 cut(s)	249
EcoRII	CCWGG	1 cut(s)	35
Esp3I	CGTCTC	1 cut(s)	140
FaiI	YATR	4 cut(s)	116, 118, 120, 156
FokI	GGATG	1 cut(s)	74
HaeIII	GGCC	1 cut(s)	161
Hpy188I	TCNGA	2 cut(s)	61, 143
HpyF3I	CTNAG	1 cut(s)	249
LmnI	GCTCC	1 cut(s)	112
LpnPI	CCDG	3 cut(s)	22, 49, 221
MluCI	AATT	4 cut(s)	86, 97, 135, 199
MmeI	TCCRAC	2 cut(s)	193, 214
MspR9I	CCNGG	1 cut(s)	37
MvaI	CCWGG	1 cut(s)	37
Psp6I	CCWGG	1 cut(s)	35
PspGI	CCWGG	1 cut(s)	35
PspPI	GGNCC	1 cut(s)	160
Sau96I	GGNCC	1 cut(s)	160
ScrFI	CCNGG	1 cut(s)	37
SetI	ASST	1 cut(s)	226
SgeI	CNNG	6 cut(s)	23, 48, 49, 162, 206, 220
Sse9I	AATT	4 cut(s)	86, 97, 135, 199
StyD4I	CCNGG	1 cut(s)	35
TasI	AATT	4 cut(s)	86, 97, 135, 199
TspGWI	ACGGA	1 cut(s)	207

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.