Rroxscaffold_3G00220430

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
2646372 .. 2656647
10276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00220430.1

Sequence Viewer

Length: 162 bp
ATGAAGGCTTTGGTCATTTATATGTCAAGGCTTTTCCGCTCTGCCACTCGATACATATGCATGGTTTTAGGGATTGACTTCTATGACTCTCCCAACAAGTTTTTGTTCTTGAAAATTTGTATTGGAAGCAACTTGGAATTATTGCTTTTGAGTGGCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.07

Weight (kDa)

9.18

Isoelectric Point (pI)

63.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 39
AciI CCGC 1 cut(s) 37
AcsI RAATTY 1 cut(s) 114
AgsI TTSAA 1 cut(s) 112
ApoI RAATTY 1 cut(s) 114
BcgI CGANNNNNNTGC 2 cut(s) 39, 73
BspACI CCGC 1 cut(s) 37
BsrBI CCGCTC 1 cut(s) 39
CviAII CATG 1 cut(s) 61
CviJI RGCY 3 cut(s) 8, 31, 156
CviKI_1 RGCY 3 cut(s) 8, 31, 156
EcoT22I ATGCAT 1 cut(s) 62
FaeI CATG 1 cut(s) 64
FaiI YATR 7 cut(s) 21, 23, 56, 58, 62, 84, 160
FatI CATG 1 cut(s) 60
FauNDI CATATG 1 cut(s) 56
Hin1II CATG 1 cut(s) 64
HinfI GANTC 1 cut(s) 86
Hpy188III TCNNGA 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 60
Hsp92II CATG 1 cut(s) 64
MbiI CCGCTC 1 cut(s) 39
MluCI AATT 2 cut(s) 114, 137
MlyI GAGTC 1 cut(s) 80
Mph1103I ATGCAT 1 cut(s) 62
MslI CAYNNNNRTG 2 cut(s) 20, 59
NdeI CATATG 1 cut(s) 56
NlaIII CATG 1 cut(s) 64
NsiI ATGCAT 1 cut(s) 62
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
RseI CAYNNNNRTG 2 cut(s) 20, 59
SchI GAGTC 1 cut(s) 80
SgeI CNNG 6 cut(s) 39, 60, 73, 109, 121, 145
SmiMI CAYNNNNRTG 2 cut(s) 20, 59
Sse9I AATT 2 cut(s) 114, 137
SsiI CCGC 1 cut(s) 37
TaqI TCGA 1 cut(s) 49
TasI AATT 2 cut(s) 114, 137
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 114
Zsp2I ATGCAT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.