MD02G1001000.v1.1

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
37182 .. 38871
1690 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1001000.v1.1.491

Sequence Viewer

Length: 312 bp
ATGCTAGTTCTTGTGATGAAGAAACTGAAGATGACACACACCTCTGTGTTAAATGAAACGAACATAGAGGGTGTTGATTCATTGCGTTTGCTAGATCAGGATCAGACTTCAAATTTAAATCATGAAGAGAAAGGAGTGGATGACGGTCTAAGAAACTGTGAAGCAGGCCCAAGCAATAAACCTGAATGTGAAGATGTGAGTGACAAGGTAGGTCTTGAAATTGTTTTTATATTGTGCTTCCTACATGGACTTGAAGTTAGGATCTATCTAGGCCTGGTAGTGTGCTGTCTATCATGGCGTAGCAGATGTTAG

Protein Analysis

104

Amino Acids

11.58

Weight (kDa)

5.08

Isoelectric Point (pI)

44.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 108, 269
AcsI RAATTY 1 cut(s) 112
AcuI CTGAAG 1 cut(s) 47
AgsI TTSAA 3 cut(s) 111, 218, 254
AjnI CCWGG 1 cut(s) 273
AleI CACNNNNGTG 1 cut(s) 44
AlwI GGATC 2 cut(s) 108, 269
AoxI GGCC 2 cut(s) 166, 271
ApoI RAATTY 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 167
BciT130I CCWGG 1 cut(s) 275
BfaI CTAG 3 cut(s) 5, 92, 269
Bme1390I CCNGG 1 cut(s) 275
BmgT120I GGNCC 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 275
BsaBI GATNNNNATC 1 cut(s) 99
Bse3DI GCAATG 1 cut(s) 80
Bse8I GATNNNNATC 1 cut(s) 99
BseBI CCWGG 1 cut(s) 275
BseGI GGATG 1 cut(s) 145
BseJI GATNNNNATC 1 cut(s) 99
BseMI GCAATG 1 cut(s) 80
BshFI GGCC 2 cut(s) 168, 273
BsnI GGCC 2 cut(s) 168, 273
Bsp143I GATC 3 cut(s) 94, 100, 261
BspANI GGCC 2 cut(s) 168, 273
BspHI TCATGA 1 cut(s) 121
BspPI GGATC 2 cut(s) 108, 269
BsrDI GCAATG 1 cut(s) 80
BssMI GATC 3 cut(s) 94, 100, 261
Bst2UI CCWGG 1 cut(s) 275
Bst4CI ACNGT 2 cut(s) 146, 158
Bst6I CTCTTC 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 149
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 3 cut(s) 97, 103, 264
BstMBI GATC 3 cut(s) 94, 100, 261
BstNI CCWGG 1 cut(s) 275
BstSCI CCNGG 1 cut(s) 273
BstX2I RGATCY 1 cut(s) 261
BstYI RGATCY 1 cut(s) 261
BsuRI GGCC 2 cut(s) 168, 273
BtsCI GGATG 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 166
CciI TCATGA 1 cut(s) 121
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 3 cut(s) 122, 245, 294
CviJI RGCY 2 cut(s) 168, 273
CviKI_1 RGCY 2 cut(s) 168, 273
DdeI CTNAG 1 cut(s) 149
DpnI GATC 3 cut(s) 96, 102, 263
DpnII GATC 3 cut(s) 94, 100, 261
DraI TTTAAA 1 cut(s) 117
Eam1104I CTCTTC 1 cut(s) 120
EarI CTCTTC 1 cut(s) 120
Eco147I AGGCCT 1 cut(s) 273
Eco57I CTGAAG 1 cut(s) 47
EcoRII CCWGG 1 cut(s) 273
FaeI CATG 3 cut(s) 125, 248, 297
FaiI YATR 5 cut(s) 65, 123, 230, 246, 295
FatI CATG 3 cut(s) 121, 244, 293
FokI GGATG 1 cut(s) 152
FspBI CTAG 3 cut(s) 5, 92, 269
HaeIII GGCC 2 cut(s) 168, 273
Hin1II CATG 3 cut(s) 125, 248, 297
HinfI GANTC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 3 cut(s) 98, 122, 215
HpyCH4III ACNGT 2 cut(s) 146, 158
HpyF3I CTNAG 1 cut(s) 149
Hsp92II CATG 3 cut(s) 125, 248, 297
Kzo9I GATC 3 cut(s) 94, 100, 261
LpnPI CCDG 5 cut(s) 83, 150, 195, 260, 287
MaeI CTAG 3 cut(s) 5, 92, 269
MaeIII GTNAC 1 cut(s) 200
MalI GATC 3 cut(s) 96, 102, 263
MboI GATC 3 cut(s) 94, 100, 261
MboII GAAGA 4 cut(s) 31, 40, 137, 203
MflI RGATCY 1 cut(s) 261
MluCI AATT 2 cut(s) 112, 219
MnlI CCTC 2 cut(s) 52, 61
MseI TTAA 2 cut(s) 50, 116
MslI CAYNNNNRTG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 275
MvaI CCWGG 1 cut(s) 275
NdeII GATC 3 cut(s) 94, 100, 261
NlaIII CATG 3 cut(s) 125, 248, 297
NmuCI GTSAC 1 cut(s) 200
OliI CACNNNNGTG 1 cut(s) 44
PagI TCATGA 1 cut(s) 121
PceI AGGCCT 1 cut(s) 273
PfeI GAWTC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 273
PspGI CCWGG 1 cut(s) 273
PspPI GGNCC 1 cut(s) 167
PsuI RGATCY 1 cut(s) 261
RseI CAYNNNNRTG 1 cut(s) 44
SaqAI TTAA 2 cut(s) 50, 116
Sau3AI GATC 3 cut(s) 94, 100, 261
Sau96I GGNCC 1 cut(s) 167
ScrFI CCNGG 1 cut(s) 275
SetI ASST 4 cut(s) 44, 184, 210, 214
SmiI ATTTAAAT 1 cut(s) 117
SmiMI CAYNNNNRTG 1 cut(s) 44
Sse9I AATT 2 cut(s) 112, 219
SseBI AGGCCT 1 cut(s) 273
SspMI CTAG 3 cut(s) 5, 92, 269
StuI AGGCCT 1 cut(s) 273
StyD4I CCNGG 1 cut(s) 273
SwaI ATTTAAAT 1 cut(s) 117
TaaI ACNGT 2 cut(s) 146, 158
TasI AATT 2 cut(s) 112, 219
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 2 cut(s) 50, 116
Tru9I TTAA 2 cut(s) 50, 116
TseFI GTSAC 1 cut(s) 200
Tsp45I GTSAC 1 cut(s) 200
TspDTI ATGAA 4 cut(s) 32, 69, 69, 138
XapI RAATTY 1 cut(s) 112
XspI CTAG 3 cut(s) 5, 92, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.